KIFC1 Overexpression Promotes Pancreatic Carcinoma Progression via Stabilising BUB1B.
1/5 보강
Pancreatic cancer (PC) is a highly lethal tumour of the gastrointestinal tract.
APA
Cui A, Yu YX, et al. (2025). KIFC1 Overexpression Promotes Pancreatic Carcinoma Progression via Stabilising BUB1B.. Journal of cellular and molecular medicine, 29(16), e70767. https://doi.org/10.1111/jcmm.70767
MLA
Cui A, et al.. "KIFC1 Overexpression Promotes Pancreatic Carcinoma Progression via Stabilising BUB1B.." Journal of cellular and molecular medicine, vol. 29, no. 16, 2025, pp. e70767.
PMID
40857057 ↗
Abstract 한글 요약
Pancreatic cancer (PC) is a highly lethal tumour of the gastrointestinal tract. New molecular targets are urgently needed for its treatment. Kinesin family member C1 (KIFC1) is implicated in the development and progression of several types of cancer. Previous studies from our group demonstrated that KIFC1 overexpression in hepatocellular carcinoma promotes malignant behaviours via the PI3K/AKT pathway. However, the molecular and functional mechanisms of KIFC1 in PC are not yet fully elaborated. In this study, KIFC1 and BUB1B were significantly upregulated in PC patient samples, and high KIFC1 expression was closely associated with the malignant phenotype and poorer overall survival (OS) in PC patients. Functional experiments showed that KIFC1 knockdown inhibited PC cell growth in vivo and in vitro, blocked cell cycle progression and hindered cell migration and invasion. In addition, rescue experiments showed that KIFC1 induced PC cell malignant behaviours dependent on BUB1B. Mechanistically, KIFC1 regulates BUB1B expression by competitively binding to BUB1B and reducing its ubiquitination and degradation. We have shown for the first time the molecular regulatory mechanism between KIFC1 and BUB1B on PC. Therefore, KIFC1 shows promise as an attractive therapeutic target for PC in the future.
🏷️ 키워드 / MeSH 📖 같은 키워드 OA만
- Humans
- Kinesins
- Pancreatic Neoplasms
- Gene Expression Regulation
- Neoplastic
- Cell Line
- Tumor
- Protein Serine-Threonine Kinases
- Cell Proliferation
- Disease Progression
- Animals
- Cell Movement
- Male
- Mice
- Cell Cycle Proteins
- Female
- Nude
- Middle Aged
- Prognosis
- BUB1B
- KIFC1
- pancreatic cancer
- protein interactions
- tumorigenesis
… 외 1개
같은 제1저자의 인용 많은 논문 (2)
- Attenuated S. typhimurium delivery of STAT3-siRNA and endostatin co-expression plasmids for immune and angiogenesis modulation in colorectal cancer.
- Case Reports: A role of postoperative radiation therapy in completely resected early stage intrathyroid thymic carcinoma: a case report and literature review of the diagnosis and treatment.
📖 전문 본문 읽기 PMC JATS · ~63 KB · 영문
Introduction
1
Introduction
Pancreatic cancer (PC) causes approximately 50,000 deaths each year in America. Unfortunately, most PC patients have a poor prognosis. Investigations have shown that the 5‐year survival rate for patients with PC is only 13% [1]. Surgical removal of the lesion is currently the only viable option for eradicating PC, but early metastasis or extensive local invasion renders resection for PC patients less than 20% [2, 3]. Although adjuvant and systemic chemotherapy are currently indispensable therapeutic methods for improving long‐term outcomes, their effects are still unclear [4].
In 1985, Ronald D. Vale discovered kinesins in squid giant axons that induce microtubule movement [5]. To date, 14 distinct families of kinesin superfamily proteins (KIFs) have been identified, ranging from KIF1 to KIF14 [6]. KIFs participate in a range of cellular processes, including synaptic vesicle transport, centrosome clustering and chromosomal transport during mitosis or meiosis, due to their function as molecular motors [7, 8]. Kinesin family member C1 (KIFC1) is a member of the kinesin‐14 family of C‐type kinesins. Previous research has shown that KIFC1 is linked to the development and progression of several types of tumours, including prostate carcinoma [9], breast carcinoma [10], gastric carcinoma [11], endometrial carcinoma [12] and non‐small cell lung carcinoma [13]. Our previous experiments showed that KIFC1 is significantly overexpressed in hepatocellular carcinoma and contributes to the progression of the disease, resulting in a poor prognosis [14]. However, subsequent studies by Zhang et al. utilised functional tests to establish a correlation between KIFC1 and PC progression [15], while Deng et al. proceeded to investigate the regulatory function of the DD6X/KIFC1 axis in PC progression [16]. However, our research has revealed more interesting and specific molecular mechanisms of KIFC1 in PC progression.
The BUB1B protein plays a crucial regulatory role in mitosis, as demonstrated by recent studies [17]. It encodes a protein kinase that activates the spindle checkpoint by phosphorylating members of the mitotic checkpoint complex [18, 19, 20]. Various types of cancer, including bladder [21], pancreatic [22] and breast cancers [23], have been linked to mutations in BUB1B. According to Xin Fu et al., BUB1B was significantly enriched in the WNT signalling pathway [24]. FBXW7 has E3 ubiquitination ligase activity, and Vishnu M. Nair et al. reported that BUB1B can undergo ubiquitination degradation by FBXW7 [25]. However, the function and molecular mechanism of BUB1B in PC have not been reported.
The Wnt signalling pathway was initially identified in a mouse mammary tumour virus model and was designated Int‐1 by Roel Nusse [26]. The Wnt/β‐catenin signalling pathway is a canonical signalling pathway in which the β‐catenin protein plays a key role. In the nucleus, β‐catenin binds to DNA‐binding proteins of the T‐cell factor/lymphoid enhancing factor (TCF/LEF) family, leading to the activation of downstream target genes. Wnt pathway activation is inhibited by the degradation of β‐catenin, which is phosphorylated by a disruption complex composed of APC, Axin and GSK3β. This phosphorylation recruits the E3 ubiquitin ligase containing β‐TrCP to degrade β‐catenin [27].
However, the molecular interactions between the KIFC1, BUB1B and Wnt signalling pathways in PC have not been fully elucidated. Our study revealed that KIFC1 stabilises BUB1B, ultimately activating the Wnt pathway and promoting PC development. This study provides a new molecular mechanism of KIFC1 in PC development and identifies new targets for the future treatment of PC.
Introduction
Pancreatic cancer (PC) causes approximately 50,000 deaths each year in America. Unfortunately, most PC patients have a poor prognosis. Investigations have shown that the 5‐year survival rate for patients with PC is only 13% [1]. Surgical removal of the lesion is currently the only viable option for eradicating PC, but early metastasis or extensive local invasion renders resection for PC patients less than 20% [2, 3]. Although adjuvant and systemic chemotherapy are currently indispensable therapeutic methods for improving long‐term outcomes, their effects are still unclear [4].
In 1985, Ronald D. Vale discovered kinesins in squid giant axons that induce microtubule movement [5]. To date, 14 distinct families of kinesin superfamily proteins (KIFs) have been identified, ranging from KIF1 to KIF14 [6]. KIFs participate in a range of cellular processes, including synaptic vesicle transport, centrosome clustering and chromosomal transport during mitosis or meiosis, due to their function as molecular motors [7, 8]. Kinesin family member C1 (KIFC1) is a member of the kinesin‐14 family of C‐type kinesins. Previous research has shown that KIFC1 is linked to the development and progression of several types of tumours, including prostate carcinoma [9], breast carcinoma [10], gastric carcinoma [11], endometrial carcinoma [12] and non‐small cell lung carcinoma [13]. Our previous experiments showed that KIFC1 is significantly overexpressed in hepatocellular carcinoma and contributes to the progression of the disease, resulting in a poor prognosis [14]. However, subsequent studies by Zhang et al. utilised functional tests to establish a correlation between KIFC1 and PC progression [15], while Deng et al. proceeded to investigate the regulatory function of the DD6X/KIFC1 axis in PC progression [16]. However, our research has revealed more interesting and specific molecular mechanisms of KIFC1 in PC progression.
The BUB1B protein plays a crucial regulatory role in mitosis, as demonstrated by recent studies [17]. It encodes a protein kinase that activates the spindle checkpoint by phosphorylating members of the mitotic checkpoint complex [18, 19, 20]. Various types of cancer, including bladder [21], pancreatic [22] and breast cancers [23], have been linked to mutations in BUB1B. According to Xin Fu et al., BUB1B was significantly enriched in the WNT signalling pathway [24]. FBXW7 has E3 ubiquitination ligase activity, and Vishnu M. Nair et al. reported that BUB1B can undergo ubiquitination degradation by FBXW7 [25]. However, the function and molecular mechanism of BUB1B in PC have not been reported.
The Wnt signalling pathway was initially identified in a mouse mammary tumour virus model and was designated Int‐1 by Roel Nusse [26]. The Wnt/β‐catenin signalling pathway is a canonical signalling pathway in which the β‐catenin protein plays a key role. In the nucleus, β‐catenin binds to DNA‐binding proteins of the T‐cell factor/lymphoid enhancing factor (TCF/LEF) family, leading to the activation of downstream target genes. Wnt pathway activation is inhibited by the degradation of β‐catenin, which is phosphorylated by a disruption complex composed of APC, Axin and GSK3β. This phosphorylation recruits the E3 ubiquitin ligase containing β‐TrCP to degrade β‐catenin [27].
However, the molecular interactions between the KIFC1, BUB1B and Wnt signalling pathways in PC have not been fully elucidated. Our study revealed that KIFC1 stabilises BUB1B, ultimately activating the Wnt pathway and promoting PC development. This study provides a new molecular mechanism of KIFC1 in PC development and identifies new targets for the future treatment of PC.
Materials and Methods
2
Materials and Methods
2.1
Patients and Tissue Samples
This study included 62 patients with PC who were pathologically diagnosed between 2016 and 2023 and who underwent pancreatectomy at the Department of Hepatobiliary Surgery of the Second Affiliated Hospital of Nanchang University. The specimens were subjected to immunohistochemical analysis after being embedded in formalin and paraffin. The patients' clinicopathological data were also collected. All patients provided informed consent. Tumour staging was determined according to the Union for International Cancer Control TNM classification guide (8th edition, 2019). The Ethics Committee of the Second Affiliated Hospital approved the study (Approval No. Review [2021] No. 039).
2.2
Cell Lines
PANC‐1, SW‐1990, BXPC‐3, ASPC‐1 and H6C7 (human normal pancreatic ductal epithelial cells) cells were purchased from the Institutes for Life Sciences, Chinese Academy of Sciences (Beijing, China). SW1990, H6C7 and other cell lines were cultured in DMEM (Thermo Fisher, 12,430,054, USA) supplemented with 10% foetal bovine serum (FBS, HyClone, SH30396.02, USA) and 1% penicillin–streptomycin, in a humidified incubator at 37°C with 5% CO2. ASPC‐1 cells were maintained in RPMI‐1640 medium (Thermo Fisher, 11,875,119, USA) with 10% FBS under the same incubation conditions. The culture medium was refreshed every 2–3 days.
2.3
Immunohistochemistry
Tissue specimens were dewaxed in xylene and rehydrated in a graded series of ethanol. Afterwards, the tissue sections were placed in a pressure cooker at 100°C for 15 min to repair the antigens. Subsequently, the sections were incubated with H2O2 for 15 min at room temperature to block endogenous peroxidase activity. Next, the sections were blocked with goat serum (Thermo Fisher, 16,210,064, USA) for 30 min. Next, the sections were incubated with an anti‐KIFC1 antibody (1:200, ORIGENE, TA38608) at 4°C overnight. Afterwards, the sections were incubated with the corresponding secondary antibodies. Both the staining intensity and area of positive staining for KIFC1 were evaluated by two pathologists in a mutually blinded manner. Staining was graded as 0 (negative), 1 (weakly positive), 2 (moderate) or 3 (strongly positive) based on the intensity of staining. The extent of staining was scored as 1 (< 10%), 2 (10%–40%), 3 (40%–75%) or 4 (>75%). The intensity and extent of the staining were multiplied to obtain a total staining score. The KIFC1 score ranged from 0 to 12, which allowed the specimens to be categorised into a low‐expression group (0–3) and a high‐expression group [3–12].
2.4
Data Mining and Bioinformatics Analysis
The expression profiles of KIFC1 and BUB1B in PC and their respective survival curves were obtained from the Gene Expression Profiling Interactive Analysis (GEPIA) online database (http://gepia.cancer‐pku.cn/). KIFC1 and BUB1B gene correlation analyses were performed with the Gene_Corr module of the TIMER2.0 database (http://timer.cistrome.org/). The PPIs were first identified from the STRING database and then mapped using Cytoscape v3.9.0 software. Hub genes were identified using the CytoHubba plugin in Cytoscape based on the Degree algorithm. The node with the highest degree was highlighted as the central hub and visually represented by a larger size and deeper red colour, indicating greater connectivity. The GSE107160, GSE16515, and GSE15471 datasets were obtained from the GEO database (https://www.ncbi.nlm.nih.gov/geo/).
2.5
Cell Transfection and Reagents
Small interfering RNA (siRNA) targeting KIFC1 and lentiviruses for the knockdown or overexpression of KIFC1 and BUB1B were purchased from General Biol (Anhui, China). The recombinant plasmids used were obtained from Gene Pharma (Shanghai, China). Cells were transfected using Lipofectamine 2000 (Invitrogen, 11,668–019, USA) according to the manufacturer's protocol to obtain stable overexpression or knockdown cell lines. AZ82 (AZ82, a KIFC1 inhibitor) was procured from Cayman (Michigan, USA) for the purpose of inhibiting kinesin. The sequences of the siRNAs used were as follows: siRNA1: 5′‐GGACUUAAAGGGUCAGUUATT‐3′ and siRNA2: 5′‐CGGGAACGCCUUCGGGAAATT‐3′.
2.6
Quantitative Real‐Time PCR (qRT–PCR)
The expression of KIFC1 was assessed by qRT–PCR. Total RNA was isolated from PC cells using TRIzol reagent, and cDNA was obtained by reverse transcription according to the instructions of TRAN One‐Step gDNA Removal and cDNA Synthesis SuperMix Kits (TransGen, AE311, China). qRT–PCR was subsequently performed using SYBR Premix Ex Taq II Kits (Takara, RR420B, USA). The 2−ΔΔCt method was used to calculate KIFC1 using GAPDH as an internal reference [28] for relative expression. The sequences of the primers used were as follows: KIFC1‐F: 5′‐GCAGGAACTCAAGGGCAA‐3′, KIFC1‐R: 5′‐GCTAAGGCGGGGTTGGAG‐3′; and GAPDH‐F: 5′‐GGACCTGACCTGCCGTCTAG‐3′; GAPDH‐R: 5′‐GTAGCCCAGGATGCCCTTGA‐3′.
2.7
Western Blotting and In Vitro Ubiquitination Assay
Cell or tissue samples were lysed using RIPA lysis buffer supplemented with protease inhibitors. The proteins were separated by SDS–PAGE using either an 8% or 10% gel and then transferred to 0.22 μm PVDF membranes (Millipore, ISEQ00010, USA). The membranes were blocked with 5% skim milk and incubated with primary antibodies overnight at 4°C. The strips were then washed with TBST and incubated with secondary antibodies for 1 h at room temperature. Finally, the strips were visualised using a bioimaging system and analysed with ImageJ software. For the in vitro ubiquitination assay, PC cells subjected to KIFC1 knockdown or overexpression were exposed to MG132 treatment for 6 h before harvesting. The cell lysates were prepared and immunoprecipitated with anti‐BUB1B antibody. The ubiquitination level of BUB1B was assessed using an anti‐Ub antibody.
Primary antibodies against Ub (Abcam, ab134953), KIFC1 (cat. no. TA384608, ORIGENE), BUB1B (cat. no. HA60053, HUABIO), β‐catenin (cat. no. #8480, Cell Signaling Technology), TCF‐4 (cat. no. #2569, Cell Signaling Technology), c‐Myc (cat. no. #9402, Cell Signaling Technology), cyclin D1 (cat. no. #55506, Cell Signaling Technology), N‐cadherin (cat. no. #13116, Cell Signaling Technology), E‐cadherin (cat. no. #3195, Cell Signaling Technology), vimentin (cat. no. #5741, Cell Signaling Technology) and GAPDH (cat. no. #5174, Cell Signaling Technology) were used.
2.8
Cell Counting Kit‐8
The transfected cells were inoculated into 96‐well plates at a density of 4000 cells per well and cultured for 24, 48 or 72 h. Then, 10 μL of CCK‐8 (Abcam, ab228554, USA) reagent was added to each well at the end of each incubation cycle. After a 2 h incubation, the absorbance of each well at 450 nm was measured using a microplate reader.
2.9
Colony Formation Assay
Cells that had been transfected and resuspended were inoculated into six‐well plates at a density of 800 cells per well. The cells were cultured for 14 days, and the cells in each well were fixed with paraformaldehyde for 30 min at room temperature and then stained with crystal violet for 10 min. A microscope was used to count the number of cell clusters.
2.10
Cell Proliferation Assay
Cell proliferation was assessed by a 5‐ethynyl‐2'deoxyuridine (EdU) proliferation assay, and an EdU kit (UElandy, C6044S, China) was purchased from UElandy Biotechnology Co. in Suzhou, China. Transfected and resuspended cells were inoculated into 96‐well plates at 1 × 105 cells per well. Once the cells had attached to the wall, the EdU reagent was added to the medium, and the cells were incubated for 2 h. After this, the cells were fixed with 4% paraformaldehyde and destained with glycine, and the cell membrane was permeabilised with 0.5% Triton X‐100. YF 594 or YF 488 was added for 30 min at 25°C in the dark. After washing, Hoechst 33,342 was added for another 30 min under the same conditions. Images were acquired using a fluorescence microscope.
2.11
Wound Healing
The fused cells were treated with mitomycin (1 μg/mL) for 1 h after being switched to serum‐free medium. Vertical scratches were made at the bottom using a 200‐μL pipette gun tip. The shed cells were washed away with PBS, and the scratches were imaged at 0 h. Images were captured again 24 h after incubation, and the rate of cell migration was calculated.
2.12
Transwell Assay
For the invasion assay, Matrigel was spread into Transwell chambers. Transfected cells were then resuspended in serum‐free DMEM and added to the upper chambers, while DMEM containing 10% FBS was added to the lower chambers. The chambers were incubated for 48 h in a 24‐well plate. After incubation, the chambers were fixed with 4% paraformaldehyde for 25 min and stained with crystal violet for 5 min. Images were captured using a microscope, and the cells were counted.
2.13
Cell Cycle Assay
A total of 1 × 105 posttransfection cells were collected and fixed with precooled 70% ethanol in a refrigerator at 4°C overnight. The following day, the cells were washed twice with PBS, stained with 0.5 mL of PI/RNase (Abcam, ab112116, USA) and resuspended. The cells were incubated for 30 min at room temperature in the dark. Afterwards, the cell cycle distribution was analysed using flow cytometry.
2.14
Animal Experiments
Female BALB/c nude mice (6–8 weeks old) weighing 15 ± 1 g from Beijing SPF Biotechnology Co. Ltd. were used to construct a xenograft tumour model. All animal experiments were conducted at Nanchang Royo Biotech Co. Ltd. The aim of this study was to investigate the effect of KIFC1 on tumour formation in vivo.
The mice were injected subcutaneously with 1 × 106 PANC‐1 cells (with stable KIFC1 knockdown) resuspended in 100 μL of serum‐free DMEM. Tumour volumes were measured at 5‐day intervals, and images of the mice were captured after 30 days using a small animal live imager. After the mice were euthanized, the tumour tissue was removed for detection. All animal experiments were approved by the Institutional Animal Care and Use Committee of Nanchang Royo Biotech Co. Ltd. (Nanchang, China, IACUC No. RYE2024033001).
2.15
Statistical Analysis
All analyses were performed using SPSS 26.0 software. Survival curves were plotted using the Kaplan–Meier method and compared using the log‐rank test, and the association between KIFC1 and clinicopathology was tested using the χ
2 test. Bivariate correlations were calculated using Pearson's correlation coefficient. Comparisons between two groups were made using two independent samples t tests, and differences were considered statistically significant at p < 0.05. The data are presented as mean ± SD, and p < 0.05 was considered to indicate statistical significance.
Materials and Methods
2.1
Patients and Tissue Samples
This study included 62 patients with PC who were pathologically diagnosed between 2016 and 2023 and who underwent pancreatectomy at the Department of Hepatobiliary Surgery of the Second Affiliated Hospital of Nanchang University. The specimens were subjected to immunohistochemical analysis after being embedded in formalin and paraffin. The patients' clinicopathological data were also collected. All patients provided informed consent. Tumour staging was determined according to the Union for International Cancer Control TNM classification guide (8th edition, 2019). The Ethics Committee of the Second Affiliated Hospital approved the study (Approval No. Review [2021] No. 039).
2.2
Cell Lines
PANC‐1, SW‐1990, BXPC‐3, ASPC‐1 and H6C7 (human normal pancreatic ductal epithelial cells) cells were purchased from the Institutes for Life Sciences, Chinese Academy of Sciences (Beijing, China). SW1990, H6C7 and other cell lines were cultured in DMEM (Thermo Fisher, 12,430,054, USA) supplemented with 10% foetal bovine serum (FBS, HyClone, SH30396.02, USA) and 1% penicillin–streptomycin, in a humidified incubator at 37°C with 5% CO2. ASPC‐1 cells were maintained in RPMI‐1640 medium (Thermo Fisher, 11,875,119, USA) with 10% FBS under the same incubation conditions. The culture medium was refreshed every 2–3 days.
2.3
Immunohistochemistry
Tissue specimens were dewaxed in xylene and rehydrated in a graded series of ethanol. Afterwards, the tissue sections were placed in a pressure cooker at 100°C for 15 min to repair the antigens. Subsequently, the sections were incubated with H2O2 for 15 min at room temperature to block endogenous peroxidase activity. Next, the sections were blocked with goat serum (Thermo Fisher, 16,210,064, USA) for 30 min. Next, the sections were incubated with an anti‐KIFC1 antibody (1:200, ORIGENE, TA38608) at 4°C overnight. Afterwards, the sections were incubated with the corresponding secondary antibodies. Both the staining intensity and area of positive staining for KIFC1 were evaluated by two pathologists in a mutually blinded manner. Staining was graded as 0 (negative), 1 (weakly positive), 2 (moderate) or 3 (strongly positive) based on the intensity of staining. The extent of staining was scored as 1 (< 10%), 2 (10%–40%), 3 (40%–75%) or 4 (>75%). The intensity and extent of the staining were multiplied to obtain a total staining score. The KIFC1 score ranged from 0 to 12, which allowed the specimens to be categorised into a low‐expression group (0–3) and a high‐expression group [3–12].
2.4
Data Mining and Bioinformatics Analysis
The expression profiles of KIFC1 and BUB1B in PC and their respective survival curves were obtained from the Gene Expression Profiling Interactive Analysis (GEPIA) online database (http://gepia.cancer‐pku.cn/). KIFC1 and BUB1B gene correlation analyses were performed with the Gene_Corr module of the TIMER2.0 database (http://timer.cistrome.org/). The PPIs were first identified from the STRING database and then mapped using Cytoscape v3.9.0 software. Hub genes were identified using the CytoHubba plugin in Cytoscape based on the Degree algorithm. The node with the highest degree was highlighted as the central hub and visually represented by a larger size and deeper red colour, indicating greater connectivity. The GSE107160, GSE16515, and GSE15471 datasets were obtained from the GEO database (https://www.ncbi.nlm.nih.gov/geo/).
2.5
Cell Transfection and Reagents
Small interfering RNA (siRNA) targeting KIFC1 and lentiviruses for the knockdown or overexpression of KIFC1 and BUB1B were purchased from General Biol (Anhui, China). The recombinant plasmids used were obtained from Gene Pharma (Shanghai, China). Cells were transfected using Lipofectamine 2000 (Invitrogen, 11,668–019, USA) according to the manufacturer's protocol to obtain stable overexpression or knockdown cell lines. AZ82 (AZ82, a KIFC1 inhibitor) was procured from Cayman (Michigan, USA) for the purpose of inhibiting kinesin. The sequences of the siRNAs used were as follows: siRNA1: 5′‐GGACUUAAAGGGUCAGUUATT‐3′ and siRNA2: 5′‐CGGGAACGCCUUCGGGAAATT‐3′.
2.6
Quantitative Real‐Time PCR (qRT–PCR)
The expression of KIFC1 was assessed by qRT–PCR. Total RNA was isolated from PC cells using TRIzol reagent, and cDNA was obtained by reverse transcription according to the instructions of TRAN One‐Step gDNA Removal and cDNA Synthesis SuperMix Kits (TransGen, AE311, China). qRT–PCR was subsequently performed using SYBR Premix Ex Taq II Kits (Takara, RR420B, USA). The 2−ΔΔCt method was used to calculate KIFC1 using GAPDH as an internal reference [28] for relative expression. The sequences of the primers used were as follows: KIFC1‐F: 5′‐GCAGGAACTCAAGGGCAA‐3′, KIFC1‐R: 5′‐GCTAAGGCGGGGTTGGAG‐3′; and GAPDH‐F: 5′‐GGACCTGACCTGCCGTCTAG‐3′; GAPDH‐R: 5′‐GTAGCCCAGGATGCCCTTGA‐3′.
2.7
Western Blotting and In Vitro Ubiquitination Assay
Cell or tissue samples were lysed using RIPA lysis buffer supplemented with protease inhibitors. The proteins were separated by SDS–PAGE using either an 8% or 10% gel and then transferred to 0.22 μm PVDF membranes (Millipore, ISEQ00010, USA). The membranes were blocked with 5% skim milk and incubated with primary antibodies overnight at 4°C. The strips were then washed with TBST and incubated with secondary antibodies for 1 h at room temperature. Finally, the strips were visualised using a bioimaging system and analysed with ImageJ software. For the in vitro ubiquitination assay, PC cells subjected to KIFC1 knockdown or overexpression were exposed to MG132 treatment for 6 h before harvesting. The cell lysates were prepared and immunoprecipitated with anti‐BUB1B antibody. The ubiquitination level of BUB1B was assessed using an anti‐Ub antibody.
Primary antibodies against Ub (Abcam, ab134953), KIFC1 (cat. no. TA384608, ORIGENE), BUB1B (cat. no. HA60053, HUABIO), β‐catenin (cat. no. #8480, Cell Signaling Technology), TCF‐4 (cat. no. #2569, Cell Signaling Technology), c‐Myc (cat. no. #9402, Cell Signaling Technology), cyclin D1 (cat. no. #55506, Cell Signaling Technology), N‐cadherin (cat. no. #13116, Cell Signaling Technology), E‐cadherin (cat. no. #3195, Cell Signaling Technology), vimentin (cat. no. #5741, Cell Signaling Technology) and GAPDH (cat. no. #5174, Cell Signaling Technology) were used.
2.8
Cell Counting Kit‐8
The transfected cells were inoculated into 96‐well plates at a density of 4000 cells per well and cultured for 24, 48 or 72 h. Then, 10 μL of CCK‐8 (Abcam, ab228554, USA) reagent was added to each well at the end of each incubation cycle. After a 2 h incubation, the absorbance of each well at 450 nm was measured using a microplate reader.
2.9
Colony Formation Assay
Cells that had been transfected and resuspended were inoculated into six‐well plates at a density of 800 cells per well. The cells were cultured for 14 days, and the cells in each well were fixed with paraformaldehyde for 30 min at room temperature and then stained with crystal violet for 10 min. A microscope was used to count the number of cell clusters.
2.10
Cell Proliferation Assay
Cell proliferation was assessed by a 5‐ethynyl‐2'deoxyuridine (EdU) proliferation assay, and an EdU kit (UElandy, C6044S, China) was purchased from UElandy Biotechnology Co. in Suzhou, China. Transfected and resuspended cells were inoculated into 96‐well plates at 1 × 105 cells per well. Once the cells had attached to the wall, the EdU reagent was added to the medium, and the cells were incubated for 2 h. After this, the cells were fixed with 4% paraformaldehyde and destained with glycine, and the cell membrane was permeabilised with 0.5% Triton X‐100. YF 594 or YF 488 was added for 30 min at 25°C in the dark. After washing, Hoechst 33,342 was added for another 30 min under the same conditions. Images were acquired using a fluorescence microscope.
2.11
Wound Healing
The fused cells were treated with mitomycin (1 μg/mL) for 1 h after being switched to serum‐free medium. Vertical scratches were made at the bottom using a 200‐μL pipette gun tip. The shed cells were washed away with PBS, and the scratches were imaged at 0 h. Images were captured again 24 h after incubation, and the rate of cell migration was calculated.
2.12
Transwell Assay
For the invasion assay, Matrigel was spread into Transwell chambers. Transfected cells were then resuspended in serum‐free DMEM and added to the upper chambers, while DMEM containing 10% FBS was added to the lower chambers. The chambers were incubated for 48 h in a 24‐well plate. After incubation, the chambers were fixed with 4% paraformaldehyde for 25 min and stained with crystal violet for 5 min. Images were captured using a microscope, and the cells were counted.
2.13
Cell Cycle Assay
A total of 1 × 105 posttransfection cells were collected and fixed with precooled 70% ethanol in a refrigerator at 4°C overnight. The following day, the cells were washed twice with PBS, stained with 0.5 mL of PI/RNase (Abcam, ab112116, USA) and resuspended. The cells were incubated for 30 min at room temperature in the dark. Afterwards, the cell cycle distribution was analysed using flow cytometry.
2.14
Animal Experiments
Female BALB/c nude mice (6–8 weeks old) weighing 15 ± 1 g from Beijing SPF Biotechnology Co. Ltd. were used to construct a xenograft tumour model. All animal experiments were conducted at Nanchang Royo Biotech Co. Ltd. The aim of this study was to investigate the effect of KIFC1 on tumour formation in vivo.
The mice were injected subcutaneously with 1 × 106 PANC‐1 cells (with stable KIFC1 knockdown) resuspended in 100 μL of serum‐free DMEM. Tumour volumes were measured at 5‐day intervals, and images of the mice were captured after 30 days using a small animal live imager. After the mice were euthanized, the tumour tissue was removed for detection. All animal experiments were approved by the Institutional Animal Care and Use Committee of Nanchang Royo Biotech Co. Ltd. (Nanchang, China, IACUC No. RYE2024033001).
2.15
Statistical Analysis
All analyses were performed using SPSS 26.0 software. Survival curves were plotted using the Kaplan–Meier method and compared using the log‐rank test, and the association between KIFC1 and clinicopathology was tested using the χ
2 test. Bivariate correlations were calculated using Pearson's correlation coefficient. Comparisons between two groups were made using two independent samples t tests, and differences were considered statistically significant at p < 0.05. The data are presented as mean ± SD, and p < 0.05 was considered to indicate statistical significance.
Results
3
Results
3.1
KIFC1 Is Highly Expressed in PC Tissue and IS Associated With Advanced Clinical Stage and Poor Prognosis
Four pancreatic adenocarcinoma and paracarcinoma tissue samples were utilised for the purpose of sequencing. The intersection of these samples with the GSE107160 dataset subsequently revealed elevated levels of KIFC1 expression (Figure 1A). To explore the expression and location of KIFC1 in PC patients, we performed immunohistochemistry (IHC) analysis on 62 PC patient samples. We observed almost no KIFC1 expression in normal tissues. On the other hand, KIFC1 expression was significantly high in neoplastic tissues, and it was detected mainly in the nuclei of tumour cells (Figure 1B). This finding was supported by findings obtained from the online GEPIA database (Figure 1C). Furthermore, by analysing the clinicopathological features of 62 patients, we found that a high KIFC1 expression level was closely correlated with T stage (p = 0.016), TNM stage (p = 0.017) and histological grade (p = 0.001) in patients with PC (Table 1). These findings indicate that KIFC1 expression is clearly related to poor clinical and pathological stage. Therefore, we analysed the association between KIFC1 expression and patient survival by Kaplan–Meier analysis, and the results demonstrated that KIFC1‐high PC patients had a significantly worse overall survival (OS) than did KIFC1‐low patients (log rank p = 0.008; Figure 1E). This result was also confirmed by the GEPIA database (log rank p = 0.0059; Figure 1D).
3.2
KIFC1 Overexpression Promotes PC Cell Growth In Vitro
The KIFC1 protein and mRNA were examined by western blotting and qRT–PCR, and the results revealed that KIFC1 was more highly expressed in PC cell lines than in normal pancreatic ductal epithelial cells (Figure 1F,G). To confirm that KIFC1 promotes PC cell proliferation, two independent siRNAs and one KIFC1‐overexpressing lentiviral vector were used to silence or overexpress KIFC1, respectively. SiRNA transfection and lentivirus infection were detected in PANC‐1 and SW‐1990 cells via western blotting, and the KIFC1 protein levels decreased and increased, respectively (Figure 2A). Compared with control cells, SW‐1990 cells overexpressing KIFC1 exhibited greater cell viability, colony formation and proliferation (Figure 2B–D). However, KIFC1 knockdown in PANC‐1 cells had opposite effects on cell viability, colony formation and proliferation (Figure 2B–D). Furthermore, a cell cycle assay demonstrated that KIFC1 promoted progression through the cell cycle from the G1 to the S and G2 phases (Figure 2E).
3.3
KIFC1 Promoted PC Cell Migration and Invasion
Scratch and Transwell assays were performed in PANC‐1 and SW‐1990 cells to examine the impact of KIFC1 on PC cell migration and invasion. A scratch assay indicated that KIFC1 overexpression markedly enhanced migration, while the opposite effect was observed in the control group (Figure 3A). In addition, Transwell assays revealed that PC invasion capacity was closely related to KIFC1 expression (Figure 3B). It is widely known that epithelial–mesenchymal transition (EMT) is an indispensable factor that promotes cell migration and invasion [29, 30]. Therefore, western blotting was used to verify the key role of EMT in PC cell migration and invasion. The results demonstrated that the epithelial marker E‐cadherin was repressed; in contrast, the mesenchymal markers N‐cadherin and vimentin were increased in KIFC1‐overexpressing PC cells. However, silencing KIFC1 had the opposite effect (Figure 3C). Overall, the above results indicated that KIFC1 promoted PC cell migration and invasion.
3.4
KIFC1 Overexpression Activated the Wnt/β/Catenin Pathway in PC Cells
In a previous study, the Wnt/β/catenin pathway was verified to contribute to PC malignancy [31]. The dephosphorylation of β‐catenin prevents it from being degraded by ubiquitination, after which it accumulates in the nucleus and increases the expression of TCF/LEF. TCF/LEF subsequently interacts with downstream targets, such as c‐Myc and cyclin D1 [32]. Western blotting revealed that KIFC1 overexpression upregulated β‐catenin, TCF4, c‐My, and cyclin D1, while KIFC1 depletion downregulated the expression of these genes (Figure 3C). Thus, the results indicated that KIFC1 might affect PC malignancy by activating the Wnt/β‐catenin signalling pathway.
3.5
BUB1B Interacts With KIFC1 at the Protein Level, Is Highly Expressed in PC Patients and Is Associated With Poor Prognosis
These 2922 up‐regulated genes were selected from our sequencing data using the criteria of'p value < 0.05 and logFC > '. To identify key regulators, a PPI network was constructed from upregulated genes using STRING and visualised in Cytoscape. Degree‐based analysis via CytoHubba ranked BUB1B as the top hub gene, shown as the largest and deepest red node in the circular layout, indicating its central role in the network (Figure 4A). To investigate the relationship between KIFC1 and BUB1B in PC, we analysed transcriptomic data from The Cancer Genome Atlas (TCGA) Spearman's correlation analysis confirmed a strong positive correlation between the expression of KIFC1 and that of BUB1B in PC (r = 0.835; Figure 4B). Moreover, interactions between KIFC1 and BUB1B were observed at the protein level via Co‐IP assays (Figure 4C). To confirm the relationship between BUB1B expression levels and clinical outcomes, we selected two datasets (GSE15471 and GSE16151) from the GEO database for paired‐sample t tests. The results showed that BUB1B expression was significantly greater in tumour tissues than in adjacent normal tissues (Figure 4D). Additionally, the GEPIA database revealed high expression of BUB1B in patients with tumours, which adversely affected patient prognosis (Figure 4E,F).
3.6
BUB1B Mediates the Effect of KIFC1 on the Wnt/β‐Catenin Pathway and the Malignancy of PC Cells
Western blotting revealed that BUB1B was successfully knocked down or overexpressed (Figure 4G). EdU experiments revealed that BUB1B knockdown decreased the proliferation of PC cells, whereas BUB1B overexpression had the opposite effect (Figure 4H). Similarly, a positive correlation between BUB1B expression and cell migration and invasion ability was observed in the scratch and Transwell assays (Figure 4I,J). The knockdown and overexpression of KIFC1 in PANC‐1 cells resulted in a similar trend for BUB1B (Figure 5A). A lentivirus was used to knock down BUB1B, which reversed the positive effects of KIFC1 overexpression on the proliferation, migration and invasion ability of PANC‐1 cells (Figure 5B–D). Similarly, decreased protein levels of β‐catenin, TCF‐4, c‐Myc and cyclin D1 were observed in KIFC1‐overexpressing cells upon BUB1B silencing (Figure 5E). These results demonstrated that reducing BUB1B expression inhibits the activation of the Wnt/β‐catenin pathway induced by KIFC1 overexpression.
3.7
KIFC1 Enhances PC Growth and Activation of the Wnt/β‐Catenin Pathway In Vivo
We established subcutaneous tumour models to explore the function of KIFC1 in regulating PC tumourigenesis. Tumours with silenced KIFC1 exhibited significantly lower growth rates, weights and volumes than those in the control group (Figure 6A–C). Moreover, a small animal imaging system was used to evaluate tumour growth, and the results also verified that KIFC1 knockdown obviously suppressed cancer cell proliferation (Figure 6D). Furthermore, Western blotting revealed that KIFC1 regulates BUB1B at the protein level and affects the activation of the Wnt/β‐catenin pathway in vivo (Figure 6E). Thus, in vivo experiments confirmed that KIFC1 regulates BUB1B and the downstream Wnt/β‐catenin pathway, promoting tumour growth.
3.8
KIFC1 and FBXW7 Competitively Bind BUB1B
To gain further insight into the precise mechanism by which KIFC1 stabilises BUB1B, we explored the evidence that BUB1B has been shown to be degraded via the ubiquitination pathway [25]. It can be postulated that KIFC1 may competitively bind BUB1B with FBXW7, thereby preventing the ubiquitination of BUB1B by FBXW7. To test this hypothesis, the cells were treated with MG132(15 μM) for 0, 3, 6 and 9 h, respectively. The results demonstrated that the longer the treatment period, the more pronounced the accumulation of BUB1B (Figure 7A). Next, we explored whether KIFC1 was involved in the degradation process of BUB1B. The proteasome inhibitor MG132 was added to sh‐KIFC1 and P‐KIFC1 PC cells, and the results demonstrated that KIFC's role in regulating the protein expression level of BUB1B was abrogated (Figure 7B). Moreover, the half‐life of BUB1B was markedly extended in cells exhibiting elevated levels of KIFC1 expression (Figure 7C,D). Our evidence indicates that KIFC1 influences the protein expression level of BUB1B by stabilising the process of BUB1B degradation. To elucidate the precise mechanism through which KIFC1 regulates BUB1B, we conducted ubiquitination experiments. These demonstrated that overexpression and knockdown of KIFC1, respectively, resulted in increased and decreased ubiquitination levels of BUB1B in PC cells transfected with the sh‐KIFC1 and P‐KIFC1 plasmids (Figure 7E). It was previously established that FBXW7 is capable of ubiquitinating BUB1B (Vishnu M. Nair et al.). To further investigate whether KIFC1 competes with FBXW7 to bind BUB1B in PC cells, we designed Co‐IP experiments. The results demonstrated that a reduction in KIFC1 expression resulted in an increase in BUB1B binding to FBXW7 (Figure 7F). In conclusion, the results of these experiments indicate that KIFC1 prevents BUB1B from undergoing ubiquitination‐mediated degradation by competing with FBXW7 for binding to BUB1B.
Results
3.1
KIFC1 Is Highly Expressed in PC Tissue and IS Associated With Advanced Clinical Stage and Poor Prognosis
Four pancreatic adenocarcinoma and paracarcinoma tissue samples were utilised for the purpose of sequencing. The intersection of these samples with the GSE107160 dataset subsequently revealed elevated levels of KIFC1 expression (Figure 1A). To explore the expression and location of KIFC1 in PC patients, we performed immunohistochemistry (IHC) analysis on 62 PC patient samples. We observed almost no KIFC1 expression in normal tissues. On the other hand, KIFC1 expression was significantly high in neoplastic tissues, and it was detected mainly in the nuclei of tumour cells (Figure 1B). This finding was supported by findings obtained from the online GEPIA database (Figure 1C). Furthermore, by analysing the clinicopathological features of 62 patients, we found that a high KIFC1 expression level was closely correlated with T stage (p = 0.016), TNM stage (p = 0.017) and histological grade (p = 0.001) in patients with PC (Table 1). These findings indicate that KIFC1 expression is clearly related to poor clinical and pathological stage. Therefore, we analysed the association between KIFC1 expression and patient survival by Kaplan–Meier analysis, and the results demonstrated that KIFC1‐high PC patients had a significantly worse overall survival (OS) than did KIFC1‐low patients (log rank p = 0.008; Figure 1E). This result was also confirmed by the GEPIA database (log rank p = 0.0059; Figure 1D).
3.2
KIFC1 Overexpression Promotes PC Cell Growth In Vitro
The KIFC1 protein and mRNA were examined by western blotting and qRT–PCR, and the results revealed that KIFC1 was more highly expressed in PC cell lines than in normal pancreatic ductal epithelial cells (Figure 1F,G). To confirm that KIFC1 promotes PC cell proliferation, two independent siRNAs and one KIFC1‐overexpressing lentiviral vector were used to silence or overexpress KIFC1, respectively. SiRNA transfection and lentivirus infection were detected in PANC‐1 and SW‐1990 cells via western blotting, and the KIFC1 protein levels decreased and increased, respectively (Figure 2A). Compared with control cells, SW‐1990 cells overexpressing KIFC1 exhibited greater cell viability, colony formation and proliferation (Figure 2B–D). However, KIFC1 knockdown in PANC‐1 cells had opposite effects on cell viability, colony formation and proliferation (Figure 2B–D). Furthermore, a cell cycle assay demonstrated that KIFC1 promoted progression through the cell cycle from the G1 to the S and G2 phases (Figure 2E).
3.3
KIFC1 Promoted PC Cell Migration and Invasion
Scratch and Transwell assays were performed in PANC‐1 and SW‐1990 cells to examine the impact of KIFC1 on PC cell migration and invasion. A scratch assay indicated that KIFC1 overexpression markedly enhanced migration, while the opposite effect was observed in the control group (Figure 3A). In addition, Transwell assays revealed that PC invasion capacity was closely related to KIFC1 expression (Figure 3B). It is widely known that epithelial–mesenchymal transition (EMT) is an indispensable factor that promotes cell migration and invasion [29, 30]. Therefore, western blotting was used to verify the key role of EMT in PC cell migration and invasion. The results demonstrated that the epithelial marker E‐cadherin was repressed; in contrast, the mesenchymal markers N‐cadherin and vimentin were increased in KIFC1‐overexpressing PC cells. However, silencing KIFC1 had the opposite effect (Figure 3C). Overall, the above results indicated that KIFC1 promoted PC cell migration and invasion.
3.4
KIFC1 Overexpression Activated the Wnt/β/Catenin Pathway in PC Cells
In a previous study, the Wnt/β/catenin pathway was verified to contribute to PC malignancy [31]. The dephosphorylation of β‐catenin prevents it from being degraded by ubiquitination, after which it accumulates in the nucleus and increases the expression of TCF/LEF. TCF/LEF subsequently interacts with downstream targets, such as c‐Myc and cyclin D1 [32]. Western blotting revealed that KIFC1 overexpression upregulated β‐catenin, TCF4, c‐My, and cyclin D1, while KIFC1 depletion downregulated the expression of these genes (Figure 3C). Thus, the results indicated that KIFC1 might affect PC malignancy by activating the Wnt/β‐catenin signalling pathway.
3.5
BUB1B Interacts With KIFC1 at the Protein Level, Is Highly Expressed in PC Patients and Is Associated With Poor Prognosis
These 2922 up‐regulated genes were selected from our sequencing data using the criteria of'p value < 0.05 and logFC > '. To identify key regulators, a PPI network was constructed from upregulated genes using STRING and visualised in Cytoscape. Degree‐based analysis via CytoHubba ranked BUB1B as the top hub gene, shown as the largest and deepest red node in the circular layout, indicating its central role in the network (Figure 4A). To investigate the relationship between KIFC1 and BUB1B in PC, we analysed transcriptomic data from The Cancer Genome Atlas (TCGA) Spearman's correlation analysis confirmed a strong positive correlation between the expression of KIFC1 and that of BUB1B in PC (r = 0.835; Figure 4B). Moreover, interactions between KIFC1 and BUB1B were observed at the protein level via Co‐IP assays (Figure 4C). To confirm the relationship between BUB1B expression levels and clinical outcomes, we selected two datasets (GSE15471 and GSE16151) from the GEO database for paired‐sample t tests. The results showed that BUB1B expression was significantly greater in tumour tissues than in adjacent normal tissues (Figure 4D). Additionally, the GEPIA database revealed high expression of BUB1B in patients with tumours, which adversely affected patient prognosis (Figure 4E,F).
3.6
BUB1B Mediates the Effect of KIFC1 on the Wnt/β‐Catenin Pathway and the Malignancy of PC Cells
Western blotting revealed that BUB1B was successfully knocked down or overexpressed (Figure 4G). EdU experiments revealed that BUB1B knockdown decreased the proliferation of PC cells, whereas BUB1B overexpression had the opposite effect (Figure 4H). Similarly, a positive correlation between BUB1B expression and cell migration and invasion ability was observed in the scratch and Transwell assays (Figure 4I,J). The knockdown and overexpression of KIFC1 in PANC‐1 cells resulted in a similar trend for BUB1B (Figure 5A). A lentivirus was used to knock down BUB1B, which reversed the positive effects of KIFC1 overexpression on the proliferation, migration and invasion ability of PANC‐1 cells (Figure 5B–D). Similarly, decreased protein levels of β‐catenin, TCF‐4, c‐Myc and cyclin D1 were observed in KIFC1‐overexpressing cells upon BUB1B silencing (Figure 5E). These results demonstrated that reducing BUB1B expression inhibits the activation of the Wnt/β‐catenin pathway induced by KIFC1 overexpression.
3.7
KIFC1 Enhances PC Growth and Activation of the Wnt/β‐Catenin Pathway In Vivo
We established subcutaneous tumour models to explore the function of KIFC1 in regulating PC tumourigenesis. Tumours with silenced KIFC1 exhibited significantly lower growth rates, weights and volumes than those in the control group (Figure 6A–C). Moreover, a small animal imaging system was used to evaluate tumour growth, and the results also verified that KIFC1 knockdown obviously suppressed cancer cell proliferation (Figure 6D). Furthermore, Western blotting revealed that KIFC1 regulates BUB1B at the protein level and affects the activation of the Wnt/β‐catenin pathway in vivo (Figure 6E). Thus, in vivo experiments confirmed that KIFC1 regulates BUB1B and the downstream Wnt/β‐catenin pathway, promoting tumour growth.
3.8
KIFC1 and FBXW7 Competitively Bind BUB1B
To gain further insight into the precise mechanism by which KIFC1 stabilises BUB1B, we explored the evidence that BUB1B has been shown to be degraded via the ubiquitination pathway [25]. It can be postulated that KIFC1 may competitively bind BUB1B with FBXW7, thereby preventing the ubiquitination of BUB1B by FBXW7. To test this hypothesis, the cells were treated with MG132(15 μM) for 0, 3, 6 and 9 h, respectively. The results demonstrated that the longer the treatment period, the more pronounced the accumulation of BUB1B (Figure 7A). Next, we explored whether KIFC1 was involved in the degradation process of BUB1B. The proteasome inhibitor MG132 was added to sh‐KIFC1 and P‐KIFC1 PC cells, and the results demonstrated that KIFC's role in regulating the protein expression level of BUB1B was abrogated (Figure 7B). Moreover, the half‐life of BUB1B was markedly extended in cells exhibiting elevated levels of KIFC1 expression (Figure 7C,D). Our evidence indicates that KIFC1 influences the protein expression level of BUB1B by stabilising the process of BUB1B degradation. To elucidate the precise mechanism through which KIFC1 regulates BUB1B, we conducted ubiquitination experiments. These demonstrated that overexpression and knockdown of KIFC1, respectively, resulted in increased and decreased ubiquitination levels of BUB1B in PC cells transfected with the sh‐KIFC1 and P‐KIFC1 plasmids (Figure 7E). It was previously established that FBXW7 is capable of ubiquitinating BUB1B (Vishnu M. Nair et al.). To further investigate whether KIFC1 competes with FBXW7 to bind BUB1B in PC cells, we designed Co‐IP experiments. The results demonstrated that a reduction in KIFC1 expression resulted in an increase in BUB1B binding to FBXW7 (Figure 7F). In conclusion, the results of these experiments indicate that KIFC1 prevents BUB1B from undergoing ubiquitination‐mediated degradation by competing with FBXW7 for binding to BUB1B.
Discussion
4
Discussion
PC is a highly malignant tumour of the gastrointestinal tract, with an incidence rate almost equal to the mortality rate [33]. Due to its insidious early onset, most cases are already in advanced stages when it is detected. PC can only be eliminated through surgery, but the chances of recurrence after the procedure are high, leading to a poor prognosis [34]. Therefore, finding potential molecular targets for PC may lead to new directions for its treatment. Through a series of experiments, we confirmed that KIFC1 is highly expressed in PC cell lines and patients. KIFC1 overexpression activates the Wnt/β‐catenin pathway through stabilising BUB1B, promoting malignant behaviour and functions in PC cells. These findings indicate that the KIFC1‐BUB1B‐Wnt pathway signalling axis could be a more effective target for PC therapy.
With respect to KIFC1, growing evidence suggests that KIFC1 overexpression is strongly associated with cancer development, progression and drug resistance [35, 36]. Cancer cells typically exhibit centrosome amplification, and these cells survive and proliferate by clustering supernumerary centrosomes for bipolar division [37, 38]. Coincidentally, KIFC1 can aggregate centrosomes to achieve bipolar division of cancer cells, promoting their survival and proliferation [39, 40]. These findings demonstrate that KIFC1 may promote PC progression by facilitating centrosome aggregation in PC cells.
Furthermore, there is evidence that KIFC1 promotes endometrial cancer centrosome amplification by regulating ubiquitination of PLK [41]. FBXW7 plays a key role in inhibiting centrosome replication [42]. Our experiments further explain that in PC cells, KIFC1 relies on a competitive relationship with FBXW7, and this competitive relationship may lead to the retention of amplified centrosomes.
Previous studies have demonstrated that the Wnt/β‐catenin signalling pathway can promote PC tumourigenesis and drug resistance [43, 44]. Targeting this pathway has become a crucial initiative for treating PC and other gastrointestinal tumours [45]. In head and neck carcinoma, KIFC1 has been identified as an'activato' of the Wnt/β‐catenin signalling pathway, promoting the development of head and neck squamous cell carcinoma [46]. Our experimental results suggest that KIFC1 may promote PC development by activating the Wnt/β‐catenin signalling pathway. Further mechanistic exploration revealed that KIFC1 binds to BUB1B and stabilises it at the protein level. Knocking down BUB1B reversed the increase in cell function and Wnt/β‐catenin pathway activity caused by KIFC1 overexpression, suggesting that KIFC1 may activate the Wnt/β‐catenin pathway via BUB1B. BUB1B's function is to inhibit the activity of the anaphase‐promoting complex/cyclosome (APC/C) by blocking the binding of CDC20 to APC/C [47]. BUB1B is a crucial component in chromosome segregation, and BUB1B overexpression induces Aurora‐B hyperactivation, resulting in chromosomal missegregation and aneuploidy [48, 49]. In general, cancer cells with aneuploidy‐containing and dispersed centromeres tend to undergo multipolarisation, preventing them from dividing and leading to cell death [50]. However, KIFC1 promotes the aggregation of dispersed centrosomes in cancer cells, facilitating polar division and ensuring cell survival [39, 40]. The available evidence indicates that KIFC1 has a molecular function to stabilise BUB1B that promotes the proliferation, migration and invasion of PC cells both in vitro and in vivo by activating the downstream Wnt/β‐catenin pathway. In future studies, the precise binding sites and structural basis of the KIFC1–BUB1B interaction will be investigated, with a view to further elucidating the molecular mechanisms underlying KIFC1‐mediated BUB1B stabilisation.
Discussion
PC is a highly malignant tumour of the gastrointestinal tract, with an incidence rate almost equal to the mortality rate [33]. Due to its insidious early onset, most cases are already in advanced stages when it is detected. PC can only be eliminated through surgery, but the chances of recurrence after the procedure are high, leading to a poor prognosis [34]. Therefore, finding potential molecular targets for PC may lead to new directions for its treatment. Through a series of experiments, we confirmed that KIFC1 is highly expressed in PC cell lines and patients. KIFC1 overexpression activates the Wnt/β‐catenin pathway through stabilising BUB1B, promoting malignant behaviour and functions in PC cells. These findings indicate that the KIFC1‐BUB1B‐Wnt pathway signalling axis could be a more effective target for PC therapy.
With respect to KIFC1, growing evidence suggests that KIFC1 overexpression is strongly associated with cancer development, progression and drug resistance [35, 36]. Cancer cells typically exhibit centrosome amplification, and these cells survive and proliferate by clustering supernumerary centrosomes for bipolar division [37, 38]. Coincidentally, KIFC1 can aggregate centrosomes to achieve bipolar division of cancer cells, promoting their survival and proliferation [39, 40]. These findings demonstrate that KIFC1 may promote PC progression by facilitating centrosome aggregation in PC cells.
Furthermore, there is evidence that KIFC1 promotes endometrial cancer centrosome amplification by regulating ubiquitination of PLK [41]. FBXW7 plays a key role in inhibiting centrosome replication [42]. Our experiments further explain that in PC cells, KIFC1 relies on a competitive relationship with FBXW7, and this competitive relationship may lead to the retention of amplified centrosomes.
Previous studies have demonstrated that the Wnt/β‐catenin signalling pathway can promote PC tumourigenesis and drug resistance [43, 44]. Targeting this pathway has become a crucial initiative for treating PC and other gastrointestinal tumours [45]. In head and neck carcinoma, KIFC1 has been identified as an'activato' of the Wnt/β‐catenin signalling pathway, promoting the development of head and neck squamous cell carcinoma [46]. Our experimental results suggest that KIFC1 may promote PC development by activating the Wnt/β‐catenin signalling pathway. Further mechanistic exploration revealed that KIFC1 binds to BUB1B and stabilises it at the protein level. Knocking down BUB1B reversed the increase in cell function and Wnt/β‐catenin pathway activity caused by KIFC1 overexpression, suggesting that KIFC1 may activate the Wnt/β‐catenin pathway via BUB1B. BUB1B's function is to inhibit the activity of the anaphase‐promoting complex/cyclosome (APC/C) by blocking the binding of CDC20 to APC/C [47]. BUB1B is a crucial component in chromosome segregation, and BUB1B overexpression induces Aurora‐B hyperactivation, resulting in chromosomal missegregation and aneuploidy [48, 49]. In general, cancer cells with aneuploidy‐containing and dispersed centromeres tend to undergo multipolarisation, preventing them from dividing and leading to cell death [50]. However, KIFC1 promotes the aggregation of dispersed centrosomes in cancer cells, facilitating polar division and ensuring cell survival [39, 40]. The available evidence indicates that KIFC1 has a molecular function to stabilise BUB1B that promotes the proliferation, migration and invasion of PC cells both in vitro and in vivo by activating the downstream Wnt/β‐catenin pathway. In future studies, the precise binding sites and structural basis of the KIFC1–BUB1B interaction will be investigated, with a view to further elucidating the molecular mechanisms underlying KIFC1‐mediated BUB1B stabilisation.
Conclusion
5
Conclusion
In summary, in the clinic, KIFC1 is expressed at high levels in PC tissues and cells, which significantly reduces the overall survival and results in a poor prognosis for patients. Mechanistically, we uncovered that KIFC1 stabilises BUB1B by competitively binding to FBXW7, thereby suppressing BUB1B ubiquitination and subsequent degradation. This stabilisation activates the Wnt/β‐catenin pathway, ultimately driving pancreatic carcinogenesis (Figure 8).
Conclusion
In summary, in the clinic, KIFC1 is expressed at high levels in PC tissues and cells, which significantly reduces the overall survival and results in a poor prognosis for patients. Mechanistically, we uncovered that KIFC1 stabilises BUB1B by competitively binding to FBXW7, thereby suppressing BUB1B ubiquitination and subsequent degradation. This stabilisation activates the Wnt/β‐catenin pathway, ultimately driving pancreatic carcinogenesis (Figure 8).
Author Contributions
Author Contributions
Ao Cui: data curation (equal), formal analysis (equal), methodology (equal), validation (equal), visualization (equal), writing – original draft (equal). Ying‐Xue Yu: resources (equal), validation (equal), writing – original draft (equal). Mei‐Xue Xiong: investigation (equal), methodology (equal), validation (equal). Ji‐Yang Wang: data curation (supporting), resources (supporting), validation (supporting). Ye‐Qing Zou: funding acquisition (supporting), resources (supporting), writing – review and editing (supporting). Ya‐Qiong Zhu: funding acquisition (supporting), resources (supporting), writing – review and editing (supporting). Long‐Jian Ran: data curation (supporting), resources (supporting), validation (supporting). Yu Zhang: data curation (supporting), resources (supporting), validation (supporting). Rui‐Xiang Liu: data curation (supporting), resources (supporting), validation (supporting). Ming‐Yi Dong: data curation (supporting), resources (supporting), validation (supporting). Hui Wang: data curation (supporting), resources (supporting), validation (supporting). Lu Fang: funding acquisition (lead), resources (lead), supervision (lead), validation (lead), writing – review and editing (lead). Xiao‐Wei Fu: funding acquisition (lead), resources (lead), supervision (lead), writing – review and editing (lead).
Ao Cui: data curation (equal), formal analysis (equal), methodology (equal), validation (equal), visualization (equal), writing – original draft (equal). Ying‐Xue Yu: resources (equal), validation (equal), writing – original draft (equal). Mei‐Xue Xiong: investigation (equal), methodology (equal), validation (equal). Ji‐Yang Wang: data curation (supporting), resources (supporting), validation (supporting). Ye‐Qing Zou: funding acquisition (supporting), resources (supporting), writing – review and editing (supporting). Ya‐Qiong Zhu: funding acquisition (supporting), resources (supporting), writing – review and editing (supporting). Long‐Jian Ran: data curation (supporting), resources (supporting), validation (supporting). Yu Zhang: data curation (supporting), resources (supporting), validation (supporting). Rui‐Xiang Liu: data curation (supporting), resources (supporting), validation (supporting). Ming‐Yi Dong: data curation (supporting), resources (supporting), validation (supporting). Hui Wang: data curation (supporting), resources (supporting), validation (supporting). Lu Fang: funding acquisition (lead), resources (lead), supervision (lead), validation (lead), writing – review and editing (lead). Xiao‐Wei Fu: funding acquisition (lead), resources (lead), supervision (lead), writing – review and editing (lead).
Ethics Statement
Ethics Statement
The use of human tissue specimens for this study was approved by the Ethics Committee of the Second Affiliated Hospital of Nanchang University (Approval No. Review [2021] No. 039). Animal ethics were reviewed and approved by the Institutional Animal Care and Use Committee of Nanchang Royo Biotech Co. Ltd. (IACUC Issue No: RYE2024033001).
The use of human tissue specimens for this study was approved by the Ethics Committee of the Second Affiliated Hospital of Nanchang University (Approval No. Review [2021] No. 039). Animal ethics were reviewed and approved by the Institutional Animal Care and Use Committee of Nanchang Royo Biotech Co. Ltd. (IACUC Issue No: RYE2024033001).
Conflicts of Interest
Conflicts of Interest
The authors declare no conflicts of interest.
The authors declare no conflicts of interest.
Supporting information
Supporting information
Data S1. jcmm70767‐sup‐0001‐FigureS1.pdf.
Data S1. jcmm70767‐sup‐0001‐FigureS1.pdf.
출처: PubMed Central (JATS). 라이선스는 원 publisher 정책을 따릅니다 — 인용 시 원문을 표기해 주세요.
🏷️ 같은 키워드 · 무료전문 — 이 논문 MeSH/keyword 기반
- A Phase I Study of Hydroxychloroquine and Suba-Itraconazole in Men with Biochemical Relapse of Prostate Cancer (HITMAN-PC): Dose Escalation Results.
- Self-management of male urinary symptoms: qualitative findings from a primary care trial.
- Clinical and Liquid Biomarkers of 20-Year Prostate Cancer Risk in Men Aged 45 to 70 Years.
- Diagnostic accuracy of Ga-PSMA PET/CT versus multiparametric MRI for preoperative pelvic invasion in the patients with prostate cancer.
- Comprehensive analysis of androgen receptor splice variant target gene expression in prostate cancer.
- Clinical Presentation and Outcomes of Patients Undergoing Surgery for Thyroid Cancer.