AHCTF1 Functions as an Oncogenic Factor and Promotes Tumor Progression in Hepatocellular Carcinoma.
1/5 보강
[BACKGROUND] Hepatocellular carcinoma (HCC) is a leading cause of cancer-related mortality, with poor prognosis due to late diagnoses and limited therapeutic targets.
APA
Liu H, Zhou W, et al. (2025). AHCTF1 Functions as an Oncogenic Factor and Promotes Tumor Progression in Hepatocellular Carcinoma.. Digestive diseases and sciences, 70(11), 3743-3754. https://doi.org/10.1007/s10620-025-09187-5
MLA
Liu H, et al.. "AHCTF1 Functions as an Oncogenic Factor and Promotes Tumor Progression in Hepatocellular Carcinoma.." Digestive diseases and sciences, vol. 70, no. 11, 2025, pp. 3743-3754.
PMID
40707755 ↗
Abstract 한글 요약
[BACKGROUND] Hepatocellular carcinoma (HCC) is a leading cause of cancer-related mortality, with poor prognosis due to late diagnoses and limited therapeutic targets. The AT-hook containing transcription factor 1 (AHCTF1) is linked to various cancers, yet its role in HCC is unclear.
[AIMS] This study aimed to investigate AHCTF1's role in HCC progression.
[METHODS] Bioinformatics analysis was performed using The Cancer Genome Atlas (TCGA) database to evaluate AHCTF1 expression in HCC and normal tissues. Differentially expressed genes (DEGs) associated with AHCTF1 were identified and analyzed for enrichment in key signaling pathways. The function of AHCTF1 in HCC was assessed in vitro by overexpressing AHCTF1 in Huh7 cells and knocking it down in HepG2 cells. The effect of AHCTF1 on tumor growth and metastasis in vivo was validated through xenograft tumor models and lung metastasis models.
[RESULTS] AHCTF1 was significantly upregulated in HCC tissues and correlated with poor prognosis. Bioinformatics analysis demonstrated that DEGs associated with AHCTF1 were enriched in the PI3K-Akt and Hedgehog signaling pathways, cell adhesion, and glycolysis. Overexpression of AHCTF1 enhanced HCC cell proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) process, while knockdown of AHCTF1 suppressed these malignant phenotypes. These findings have been validated through xenograft and lung metastasis models, and AHCTF1 promotes tumor growth and metastasis.
[CONCLUSION] This study identifies AHCTF1 as a potential oncogenic factor, with high expression levels in HCC and a positive correlation with poor prognosis. AHCTF1 promotes tumor progression by enhancing the proliferation, migration, invasion, and EMT process of HCC cells.
[AIMS] This study aimed to investigate AHCTF1's role in HCC progression.
[METHODS] Bioinformatics analysis was performed using The Cancer Genome Atlas (TCGA) database to evaluate AHCTF1 expression in HCC and normal tissues. Differentially expressed genes (DEGs) associated with AHCTF1 were identified and analyzed for enrichment in key signaling pathways. The function of AHCTF1 in HCC was assessed in vitro by overexpressing AHCTF1 in Huh7 cells and knocking it down in HepG2 cells. The effect of AHCTF1 on tumor growth and metastasis in vivo was validated through xenograft tumor models and lung metastasis models.
[RESULTS] AHCTF1 was significantly upregulated in HCC tissues and correlated with poor prognosis. Bioinformatics analysis demonstrated that DEGs associated with AHCTF1 were enriched in the PI3K-Akt and Hedgehog signaling pathways, cell adhesion, and glycolysis. Overexpression of AHCTF1 enhanced HCC cell proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) process, while knockdown of AHCTF1 suppressed these malignant phenotypes. These findings have been validated through xenograft and lung metastasis models, and AHCTF1 promotes tumor growth and metastasis.
[CONCLUSION] This study identifies AHCTF1 as a potential oncogenic factor, with high expression levels in HCC and a positive correlation with poor prognosis. AHCTF1 promotes tumor progression by enhancing the proliferation, migration, invasion, and EMT process of HCC cells.
🏷️ 키워드 / MeSH 📖 같은 키워드 OA만
- Humans
- Carcinoma
- Hepatocellular
- Liver Neoplasms
- Animals
- Disease Progression
- Mice
- Cell Proliferation
- Epithelial-Mesenchymal Transition
- Gene Expression Regulation
- Neoplastic
- Signal Transduction
- Hep G2 Cells
- Cell Line
- Tumor
- Male
- Nude
- Female
- Cell Movement
- Inbred BALB C
- AHCTF1
- EMT process
- Hedgehog signaling pathway
- Hepatocellular carcinoma
… 외 1개
같은 제1저자의 인용 많은 논문 (5)
- From feasibility to translational pathways: a bibliometric and knowledge-mapping analysis of urine-based liquid biopsy in urologic cancers (2015-2025).
- The Current Status of Radionuclide Tumor Targeting Diagnosis and Therapy Based on FAP-2286: From Preclinical Studies to Clinical Application.
- Cleavage-Resistant CYLD Protects Against Autoimmune Hepatitis.
- Single-Cell Computational Frameworks for Quantifying BET Bromodomain Inhibitor Resistance and Screening Re-Sensitizer Drugs in Triple-Negative Breast Cancer.
- Target-Centric Multiplexed Screening of an Herbal Extract Identifies a Novel Dual A/A Receptor Antagonist for Cancer Immunotherapy.
📖 전문 본문 읽기 PMC JATS · ~38 KB · 영문
Introduction
Introduction
Hepatocellular carcinoma (HCC) is the most prevalent form of primary liver cancer globally and a significant contributor to cancer-related mortality [1, 2]. This malignant tumor originates from hepatocytes and typically arises in patients with liver disease, particularly chronic hepatitis and cirrhosis [3]. With the rising incidence of liver diseases, the rate of HCC has continued to escalate in recent years, posing a severe threat to global public health [3]. Treatments for HCC encompass surgical resection, liver transplantation, targeted therapy, and immunotherapy [4, 5]. Patients with early-stage HCC may derive greater therapeutic benefit from surgical intervention or liver transplantation [6, 7]. Therefore, early diagnosis of HCC is crucial for improving patient survival. However, due to the absence of specific symptoms in the early stages of HCC, most patients are diagnosed at an advanced stage, frequently resulting in the loss of the optimal treatment window [6–8]. Consequently, the identification of effective screening markers and the development of novel therapeutic strategies have become pivotal areas of focus in current research endeavors.
AT-hook containing transcription factor 1 (AHCTF1), also known as ELYS or MEL-28, is a crucial multidomain nuclear pore protein (NUP) [9]. The AT-hook domain is capable of specifically binding to AT-rich regions of DNA, thereby regulating gene expression [9, 10]. AHCTF1 is essential for nuclear pore assembly and mitosis, and plays a pivotal role in a multitude of biological processes, including cell proliferation, differentiation, cell cycle regulation, and apoptosis [11–13]. Given its distinctive functions, AHCTF1 has attracted growing interest from the researchers. Studies have indicated its potential association with a range of cancers, including colon cancer [14], thyroid cancer [15], and HCC [16]. However, there is a paucity of research examining the specific role of AHCTF1 in HCC.
In this study, we demonstrated that AHCTF1 was highly expressed in HCC and positively correlated with a poor prognosis. AHCTF1 facilitated the malignant phenotypes and EMT process of HCC cells. The pro-cancer effect of AHCTF1 was also confirmed in vivo. This study establishes a foundation for further research into the role of AHCTF1 in HCC progression and introduces new perspectives for the development of novel targeted therapeutic strategies.
Hepatocellular carcinoma (HCC) is the most prevalent form of primary liver cancer globally and a significant contributor to cancer-related mortality [1, 2]. This malignant tumor originates from hepatocytes and typically arises in patients with liver disease, particularly chronic hepatitis and cirrhosis [3]. With the rising incidence of liver diseases, the rate of HCC has continued to escalate in recent years, posing a severe threat to global public health [3]. Treatments for HCC encompass surgical resection, liver transplantation, targeted therapy, and immunotherapy [4, 5]. Patients with early-stage HCC may derive greater therapeutic benefit from surgical intervention or liver transplantation [6, 7]. Therefore, early diagnosis of HCC is crucial for improving patient survival. However, due to the absence of specific symptoms in the early stages of HCC, most patients are diagnosed at an advanced stage, frequently resulting in the loss of the optimal treatment window [6–8]. Consequently, the identification of effective screening markers and the development of novel therapeutic strategies have become pivotal areas of focus in current research endeavors.
AT-hook containing transcription factor 1 (AHCTF1), also known as ELYS or MEL-28, is a crucial multidomain nuclear pore protein (NUP) [9]. The AT-hook domain is capable of specifically binding to AT-rich regions of DNA, thereby regulating gene expression [9, 10]. AHCTF1 is essential for nuclear pore assembly and mitosis, and plays a pivotal role in a multitude of biological processes, including cell proliferation, differentiation, cell cycle regulation, and apoptosis [11–13]. Given its distinctive functions, AHCTF1 has attracted growing interest from the researchers. Studies have indicated its potential association with a range of cancers, including colon cancer [14], thyroid cancer [15], and HCC [16]. However, there is a paucity of research examining the specific role of AHCTF1 in HCC.
In this study, we demonstrated that AHCTF1 was highly expressed in HCC and positively correlated with a poor prognosis. AHCTF1 facilitated the malignant phenotypes and EMT process of HCC cells. The pro-cancer effect of AHCTF1 was also confirmed in vivo. This study establishes a foundation for further research into the role of AHCTF1 in HCC progression and introduces new perspectives for the development of novel targeted therapeutic strategies.
Materials and Methods
Materials and Methods
Bioinformatics
Based on HCC samples derived from the TCGA database, we analyzed AHCTF1 expression levels in HCC and its various stages. Additionally, we examined the correlation between AHCTF1 and survival in HCC patients. By dividing HCC samples into high and low expression groups based on the median expression level of AHCTF1, we constructed a differentially expressed genes (DEGs) volcano plot. Furthermore, to elucidate the underlying signaling pathways associated with these genes, Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) enrichment analyses were undertaken. Additionally, Gene Set Enrichment Analysis (GSEA) was conducted to explore the signaling pathways associated with the differential expression of the AHCTF1 gene was performed. All analyses were executed using the R Package. In addition, SPSS 26 statistical software facilitated an intricate exploration of the association between the target gene AHCTF1 and pertinent clinical variables.
Cell Lines and Cell Culture
The Huh7 (YDT-0003), HepG2 (YDT-0235), SK-SEP-1 (YDT-0599) and Hep3B (YDT-0233) cells used in the experiment were obtained from INDIT Bio-Technology Co., Ltd (Hangzhou, China). These cells were cultured at 37 °C in a humidified atmosphere containing 5% CO2. Cells were cultured using RPMI-1640 medium (BDBIO, Hangzhou, China, L103-500) containing 10% fetal bovine serum (FBS, SERANA, Shanghai, China, S-FBS-MX-015) and 1% penicillin/streptomycin (Gibco, CA, USA, 15140-122).
Transient Transfection
We inserted the AHCTF1 overexpression plasmid into the pCDH vector (Youbao, Hunan, China). Small interfering RNAs (si-AHCTF1-1, si-AHCTF1-2, si-AHCTF1-3) targeting AHCTF1 and their control plasmids (siR-NC) were also used. When the cells reached 80% confluence, these plasmids were diluted in Opti-MEM (Gibco, NY, USA, 31985-070). The cells were then transfected with Lipofectamine 2000 (Invitrogen, MA, USA, 11668-019) for 24 h. Transfection efficiency was validated through western blot analysis (Follow the methods listed below). The sequences of siR-AHCTF1 and siR-NC are as follows:siR-NC sense: UUCUCCGAACGAGUCACGUTT
siR-NC antisense: ACGUGACUCGUUCGGAGAATT
siR-AHCTF1-1 sense: CCCUUGGAGAAGACGAAAUAA
siR-AHCTF1-1 antisense: UUAUUUCGUCUUCUCCAAGGG
siR-AHCTF1-2 sense: CCAUAGAAAUUCGGCUGAUUU
siR-AHCTF1-2 antisense: AAAUCAGCCGAAUUUCUAUGG
siR-AHCTF1-3 sense: CCCAAACCAUUAUCAGCAGUU
siR-AHCTF1-3 antisense: AACUGCUGAUAAUGGUUUGGG
Lentiviral-Mediated AHCTF1 Overexpression
A lentiviral vector was engineered to carry an overexpression plasmid for AHCTF1 and introduced into Huh7 cells, establishing a stable transfection system. Subsequently, cells exhibiting stable overexpression of Huh7 were selected using 1 μg/mL puromycin (Thermofisher, MA, USA, A1113802). Western blot (Follow the methods listed below) was employed to confirm the successful transfection.
Western Blotting (WB) Analysis
The detailed steps of Western blotting were performed in accordance with the published description [17]. Total protein was extracted from the cells, and the protein concentration was ascertained using a BCA kit (BBI, Shanghai, China, A600260-0025). Subsequently, the protein samples were separated via SDS-PAGE and transferred onto a polyvinylidene fluoride (PVDF) membrane. After blocking with 5% BSA (Solarbio, Beijing, China, A8020), chemiluminescence was conducted utilizing ECL (Biosharp, Hefei, China, BL520B) following incubation with primary and secondary antibodies. Details about the antibodies are listed in Table 1.
Methylthiazolyl Diphenyltetrazolium Bromide (MTT) Assay
After transfection, Huh7 and HepG2 cells were added into 96-well plates with 4 × 103 cells per well. After 24, 48, and 72 h, 50 μL MTT (Sigma, MO, USA, M2128) solution was added to each well. Following a 3-h incubation, the crystals were dissolved in 150 μL DMSO (HUSHI, Shanghai, China, 30072418) solution. OD values were measured by a microplate reader (Thermofisher, MA, USA, 51119570).
Transwell Assay
The transfected Huh7 and HepG2 cells (1 × 104) were collected and seeded in the upper Transwell chamber (COSTAR, TX, USA, 3422), without the addition of serum. DMEM supplemented with 10% FBS was added to the lower Transwell chamber. After culturing for 24 h, the cells were fixed with methanol and subsequently stained with crystal violet (Aladdin, Shanghai, China, C110703). Invasion assays were performed by adding Matrigel (Corning, NY, USA, 356234) to the upper chamber half an hour in advance.
Colony Formation Assay
Transfected Huh7 and HepG2 cells were collected, and the cell density was adjusted to 1 × 103 cells per well. The cells were then seeded into a 6-well plate and cultured in a medium containing 10% FBS for 2 weeks. The medium was changed every three days. Subsequently, cells were fixed and stained for imaging. Colony numbers were counted to calculate the colony formation rate.
Xenograft Tumor Model Assay
Twelve 4-week-old female nude mice were procured from Zhejiang Vital River Laboratory Animal Technology Co. Ltd (Zhejiang, China). Huh7 cells with stable overexpression of ACHTF1 and corresponding control cells (5 × 106) were implanted subcutaneously into nude mice, and the tumor volume was measured daily using a caliper (SYNTEK, Hangzhou, China, SY-119-200). When the tumor volume reached 1500 mm3 (long diameter × short diameter2 × 1/2), the mice were euthanized humanely, and the tumor tissues were collected, photographed, and weighed. All experimental procedures in this study strictly followed the Chinese regulations for the management of experimental animals and approved by The Lab of Animal Experimental Ethical Inspection of Dr.Can Biotechnology (Zhejiang) Co., Ltd (Number: DRK20240903).
Lung Metastasis Assay
Twelve 4-week-old female nude mice were obtained from Zhejiang Weitonglihua Experimental Animal Technology Co. Ltd. (Zhejiang, China). Huh7 cells stably overexpressing ACHTF1 and their control cells (2 × 106 cells) were injected into nude mice via tail vein injection. Four weeks later, the mice were euthanized humanely. Subsequently, the lungs of the mice were extracted, and the metastatic nodules in the lungs were counted. Lung tissues were rapidly frozen in liquid nitrogen for long-term preservation, and some lung tissues were embedded in paraffin for subsequent hematoxylin and eosin (HE) staining.
Immunohistochemistry (IHC)
The collected mouse tissue samples were fixed, embedded, sectioned, and deparaffinized. The sections were rehydrated with different concentrations of ethanol. To expose hidden antigen sites, the sections were immersed in antigen retrieval solution (citrate buffer, Sigma, MO, USA, S5770). Treatment with BSA reduced nonspecific background staining. After incubation with primary and secondary antibodies, DAB (Beyotime, Shanghai, China, P0202) staining was performed, and the results were observed under a microscope.
Statistical Analysis
All experiments were replicated three times to ensure the reliability of the results. Data were analyzed using GraphPad 6.0 software (GraphPad Software, Inc., La Jolla, CA, USA), with the T-test employed for comparative analyses between the two groups. Meanwhile, comparisons involving multiple groups were conducted using one-way ANOVA. *p < 0.05 was regarded as statistically significant.
Bioinformatics
Based on HCC samples derived from the TCGA database, we analyzed AHCTF1 expression levels in HCC and its various stages. Additionally, we examined the correlation between AHCTF1 and survival in HCC patients. By dividing HCC samples into high and low expression groups based on the median expression level of AHCTF1, we constructed a differentially expressed genes (DEGs) volcano plot. Furthermore, to elucidate the underlying signaling pathways associated with these genes, Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) enrichment analyses were undertaken. Additionally, Gene Set Enrichment Analysis (GSEA) was conducted to explore the signaling pathways associated with the differential expression of the AHCTF1 gene was performed. All analyses were executed using the R Package. In addition, SPSS 26 statistical software facilitated an intricate exploration of the association between the target gene AHCTF1 and pertinent clinical variables.
Cell Lines and Cell Culture
The Huh7 (YDT-0003), HepG2 (YDT-0235), SK-SEP-1 (YDT-0599) and Hep3B (YDT-0233) cells used in the experiment were obtained from INDIT Bio-Technology Co., Ltd (Hangzhou, China). These cells were cultured at 37 °C in a humidified atmosphere containing 5% CO2. Cells were cultured using RPMI-1640 medium (BDBIO, Hangzhou, China, L103-500) containing 10% fetal bovine serum (FBS, SERANA, Shanghai, China, S-FBS-MX-015) and 1% penicillin/streptomycin (Gibco, CA, USA, 15140-122).
Transient Transfection
We inserted the AHCTF1 overexpression plasmid into the pCDH vector (Youbao, Hunan, China). Small interfering RNAs (si-AHCTF1-1, si-AHCTF1-2, si-AHCTF1-3) targeting AHCTF1 and their control plasmids (siR-NC) were also used. When the cells reached 80% confluence, these plasmids were diluted in Opti-MEM (Gibco, NY, USA, 31985-070). The cells were then transfected with Lipofectamine 2000 (Invitrogen, MA, USA, 11668-019) for 24 h. Transfection efficiency was validated through western blot analysis (Follow the methods listed below). The sequences of siR-AHCTF1 and siR-NC are as follows:siR-NC sense: UUCUCCGAACGAGUCACGUTT
siR-NC antisense: ACGUGACUCGUUCGGAGAATT
siR-AHCTF1-1 sense: CCCUUGGAGAAGACGAAAUAA
siR-AHCTF1-1 antisense: UUAUUUCGUCUUCUCCAAGGG
siR-AHCTF1-2 sense: CCAUAGAAAUUCGGCUGAUUU
siR-AHCTF1-2 antisense: AAAUCAGCCGAAUUUCUAUGG
siR-AHCTF1-3 sense: CCCAAACCAUUAUCAGCAGUU
siR-AHCTF1-3 antisense: AACUGCUGAUAAUGGUUUGGG
Lentiviral-Mediated AHCTF1 Overexpression
A lentiviral vector was engineered to carry an overexpression plasmid for AHCTF1 and introduced into Huh7 cells, establishing a stable transfection system. Subsequently, cells exhibiting stable overexpression of Huh7 were selected using 1 μg/mL puromycin (Thermofisher, MA, USA, A1113802). Western blot (Follow the methods listed below) was employed to confirm the successful transfection.
Western Blotting (WB) Analysis
The detailed steps of Western blotting were performed in accordance with the published description [17]. Total protein was extracted from the cells, and the protein concentration was ascertained using a BCA kit (BBI, Shanghai, China, A600260-0025). Subsequently, the protein samples were separated via SDS-PAGE and transferred onto a polyvinylidene fluoride (PVDF) membrane. After blocking with 5% BSA (Solarbio, Beijing, China, A8020), chemiluminescence was conducted utilizing ECL (Biosharp, Hefei, China, BL520B) following incubation with primary and secondary antibodies. Details about the antibodies are listed in Table 1.
Methylthiazolyl Diphenyltetrazolium Bromide (MTT) Assay
After transfection, Huh7 and HepG2 cells were added into 96-well plates with 4 × 103 cells per well. After 24, 48, and 72 h, 50 μL MTT (Sigma, MO, USA, M2128) solution was added to each well. Following a 3-h incubation, the crystals were dissolved in 150 μL DMSO (HUSHI, Shanghai, China, 30072418) solution. OD values were measured by a microplate reader (Thermofisher, MA, USA, 51119570).
Transwell Assay
The transfected Huh7 and HepG2 cells (1 × 104) were collected and seeded in the upper Transwell chamber (COSTAR, TX, USA, 3422), without the addition of serum. DMEM supplemented with 10% FBS was added to the lower Transwell chamber. After culturing for 24 h, the cells were fixed with methanol and subsequently stained with crystal violet (Aladdin, Shanghai, China, C110703). Invasion assays were performed by adding Matrigel (Corning, NY, USA, 356234) to the upper chamber half an hour in advance.
Colony Formation Assay
Transfected Huh7 and HepG2 cells were collected, and the cell density was adjusted to 1 × 103 cells per well. The cells were then seeded into a 6-well plate and cultured in a medium containing 10% FBS for 2 weeks. The medium was changed every three days. Subsequently, cells were fixed and stained for imaging. Colony numbers were counted to calculate the colony formation rate.
Xenograft Tumor Model Assay
Twelve 4-week-old female nude mice were procured from Zhejiang Vital River Laboratory Animal Technology Co. Ltd (Zhejiang, China). Huh7 cells with stable overexpression of ACHTF1 and corresponding control cells (5 × 106) were implanted subcutaneously into nude mice, and the tumor volume was measured daily using a caliper (SYNTEK, Hangzhou, China, SY-119-200). When the tumor volume reached 1500 mm3 (long diameter × short diameter2 × 1/2), the mice were euthanized humanely, and the tumor tissues were collected, photographed, and weighed. All experimental procedures in this study strictly followed the Chinese regulations for the management of experimental animals and approved by The Lab of Animal Experimental Ethical Inspection of Dr.Can Biotechnology (Zhejiang) Co., Ltd (Number: DRK20240903).
Lung Metastasis Assay
Twelve 4-week-old female nude mice were obtained from Zhejiang Weitonglihua Experimental Animal Technology Co. Ltd. (Zhejiang, China). Huh7 cells stably overexpressing ACHTF1 and their control cells (2 × 106 cells) were injected into nude mice via tail vein injection. Four weeks later, the mice were euthanized humanely. Subsequently, the lungs of the mice were extracted, and the metastatic nodules in the lungs were counted. Lung tissues were rapidly frozen in liquid nitrogen for long-term preservation, and some lung tissues were embedded in paraffin for subsequent hematoxylin and eosin (HE) staining.
Immunohistochemistry (IHC)
The collected mouse tissue samples were fixed, embedded, sectioned, and deparaffinized. The sections were rehydrated with different concentrations of ethanol. To expose hidden antigen sites, the sections were immersed in antigen retrieval solution (citrate buffer, Sigma, MO, USA, S5770). Treatment with BSA reduced nonspecific background staining. After incubation with primary and secondary antibodies, DAB (Beyotime, Shanghai, China, P0202) staining was performed, and the results were observed under a microscope.
Statistical Analysis
All experiments were replicated three times to ensure the reliability of the results. Data were analyzed using GraphPad 6.0 software (GraphPad Software, Inc., La Jolla, CA, USA), with the T-test employed for comparative analyses between the two groups. Meanwhile, comparisons involving multiple groups were conducted using one-way ANOVA. *p < 0.05 was regarded as statistically significant.
Results
Results
AHCTF1 Is Upregulated in Hepatocellular Carcinoma and Positively Correlates with Poor Prognosis
To investigate the function of AHCTF1 in hepatocellular carcinoma (HCC) progression, we conducted the bioinformatics analysis on HCC tissue samples from The Cancer Genome Atlas (TCGA) database, comprising 374 tumor samples and 50 normal liver samples. The analysis demonstrated a markedly elevated mRNA expression level of AHCTF1 in HCC tissues relative to normal liver tissues (Fig. 1a). Additionally, the correlation between AHCTF1 expression and clinicopathological features of HCC was analyzed by the TCGA dataset. As shown in Table 2, the expression of AHCTF1 is not markedly correlated with age (p = 0.697), regional lymph node involvement (p = 0.307), or distant metastasis (p = 0.327). However, it is significantly associated with primary tumor status (p = 0.007) and clinical stage (p = 0.007).
Further analysis of AHCTF1 expression across different clinical stages of HCC revealed a significant increase in expression levels with the advancing stage, from Stage I to Stage III (Fig. 1b). Although the expression of AHCTF1 appeared to decrease in Stage IV due to the limited number of samples, the results of the Stage I, II, and III analyses indicated a positive correlation between AHCTF1 expression and cancer stages. Furthermore, survival analysis demonstrated that patients with low AHCTF1 expression exhibited significantly higher overall survival rates compared to those with high AHCTF1 expression (Fig. 1c). These findings suggested that AHCTF1 is highly expressed in HCC and associated with a poor prognosis, thereby underscoring its potential significance in the progression of HCC.
Bioinformatics Analysis Revealed the DEGs Were Linked to PI3K-Akt and Hedgehog Signaling Pathways, Cell Adhesion, and Glycolysis
The HCC samples from TCGA database were divided into high- and low- AHCTF1 expression groups, using the median expression level of AHCTF1 as a threshold. The volcano plot of differentially expressed genes (DEGs) between the two groups exhibited that there were 42 downregulated genes and 2002 upregulated genes (Fig. 2a). Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis indicated that the DEGs were predominantly enriched in the PI3K-Akt (Phosphoinositide 3 Kinase-Protein Kinase B) and Hedgehog signaling pathways (Fig. 2b). Gene Ontology (GO) enrichment analysis indicated that the DEGs were intimately involved in biological processes related to cell adhesion (Fig. 2c). Additionally, Gene Set Enrichment Analysis (GSEA) exhibited that the DEGs were mainly concentrated within glycolysis pathway (Fig. 2d).
AHCTF1 Facilitated the Malignant Phenotypes and EMT Pathway in HCC Cells
In order to comprehensively understand the role of AHCTF1 in the progression of HCC, we examined the expression of AHCTF1 in several HCC cell lines. The results revealed that Huh7 cells exhibited relatively low endogenous expression of AHCTF1, while HepG2 cells expressed higher baseline levels of AHCTF1 (Fig. 3a). Therefore, Huh7 cells were selected as the overexpression model of AHCTF1, and HepG2 cells were selected as the knockdown model of AHCTF1. This approach was taken to more intuitively observe the effects of AHCTF1 overexpression and knockdown on cell function. The results showed that the protein level of AHCTF1 was significantly higher after 24 h of transient transfection of the overexpressing plasmid compared to the level after 48 h (Fig. 3b). Therefore, a 24-h time frame was selected as the temporal boundary for transient transfection. Then, the siRNA with the most effective knockdown, siR-AHCTF1-3, was selected for further evaluation of its impact on the malignant phenotypes of HCC cells (Fig. 3c). The results demonstrated that overexpression of AHCTF1 promoted the proliferation, migration, invasion, and colony formation of tumor cells (Fig. 3d–f). Conversely, knockdown of AHCTF1 has been observed to significantly inhibit the aforementioned abilities in HCC cells (Fig. 3d–F).
Additionally, as illustrated in Fig. 2, the DEGs identified through varying levels of AHCTF1 expression were primarily enriched in the PI3K-Akt and Hedgehog signaling pathways, as well as in processes related to cell adhesion and glycolysis. These signaling pathways and biological processes have been reported to be closely associated with the epithelial-mesenchymal transition (EMT) pathway [18–20]. Therefore, the impact of AHCTF1 on the EMT pathway was investigated. The results demonstrated that overexpression of AHCTF1 resulted in a reduction in the expression level of E-cadherin and an increase in the expression levels of N-cadherin and Vimentin, indicating that overexpression of AHCTF1 facilitated the EMT pathway. Knockdown of AHCTF1 led to the opposite effect (Fig. 3g). These findings suggested that targeting AHCTF1 could provide an effective means of suppressing the malignant phenotypes and EMT pathway in HCC cells.
AHCTF1 Promoted Tumor Growth and Lung Metastasis in HCC in vivo
To validate the effects of AHCTF1 in vivo, the xenograft tumor models were constructed by subcutaneously injecting Huh7 cells with stable overexpression of ACHTF1 (Fig. 4a) or corresponding control cells (5 × 106 cells/each) into 4-week-old female nude mice (n = 12). Consistent with the results from cell experiments in vitro, overexpression of AHCTF1 could promote tumor growth in vivo, resulting in a significant increase in both tumor volume and weight (Fig. 4b, c). Furthermore, tumor samples with AHCTF1 overexpression exhibited significantly elevated levels of Ki67, reflecting the ability of AHCTF1 to enhance the proliferation of tumor cells (Fig. 4d). To further investigate the role of AHCTF1 in HCC metastasis in vivo, we established a lung metastasis model. The results demonstrated a significant increase in pulmonary metastatic nodules and the disruption of normal structures by overexpression of AHCTF1 (Fig. 5a, b), indicating that AHCTF1 facilitated lung metastasis in HCC. These findings suggested that AHCTF1 acts as an oncogenic factor in HCC in vivo.
In summary, this study demonstrated that AHCTF1 was highly expressed in HCC and positively correlated with a poor prognosis. AHCTF1 facilitated the proliferation, migration, invasion, and EMT process in HCC cells, thereby contributing to tumor growth and metastasis in vivo.
AHCTF1 Is Upregulated in Hepatocellular Carcinoma and Positively Correlates with Poor Prognosis
To investigate the function of AHCTF1 in hepatocellular carcinoma (HCC) progression, we conducted the bioinformatics analysis on HCC tissue samples from The Cancer Genome Atlas (TCGA) database, comprising 374 tumor samples and 50 normal liver samples. The analysis demonstrated a markedly elevated mRNA expression level of AHCTF1 in HCC tissues relative to normal liver tissues (Fig. 1a). Additionally, the correlation between AHCTF1 expression and clinicopathological features of HCC was analyzed by the TCGA dataset. As shown in Table 2, the expression of AHCTF1 is not markedly correlated with age (p = 0.697), regional lymph node involvement (p = 0.307), or distant metastasis (p = 0.327). However, it is significantly associated with primary tumor status (p = 0.007) and clinical stage (p = 0.007).
Further analysis of AHCTF1 expression across different clinical stages of HCC revealed a significant increase in expression levels with the advancing stage, from Stage I to Stage III (Fig. 1b). Although the expression of AHCTF1 appeared to decrease in Stage IV due to the limited number of samples, the results of the Stage I, II, and III analyses indicated a positive correlation between AHCTF1 expression and cancer stages. Furthermore, survival analysis demonstrated that patients with low AHCTF1 expression exhibited significantly higher overall survival rates compared to those with high AHCTF1 expression (Fig. 1c). These findings suggested that AHCTF1 is highly expressed in HCC and associated with a poor prognosis, thereby underscoring its potential significance in the progression of HCC.
Bioinformatics Analysis Revealed the DEGs Were Linked to PI3K-Akt and Hedgehog Signaling Pathways, Cell Adhesion, and Glycolysis
The HCC samples from TCGA database were divided into high- and low- AHCTF1 expression groups, using the median expression level of AHCTF1 as a threshold. The volcano plot of differentially expressed genes (DEGs) between the two groups exhibited that there were 42 downregulated genes and 2002 upregulated genes (Fig. 2a). Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis indicated that the DEGs were predominantly enriched in the PI3K-Akt (Phosphoinositide 3 Kinase-Protein Kinase B) and Hedgehog signaling pathways (Fig. 2b). Gene Ontology (GO) enrichment analysis indicated that the DEGs were intimately involved in biological processes related to cell adhesion (Fig. 2c). Additionally, Gene Set Enrichment Analysis (GSEA) exhibited that the DEGs were mainly concentrated within glycolysis pathway (Fig. 2d).
AHCTF1 Facilitated the Malignant Phenotypes and EMT Pathway in HCC Cells
In order to comprehensively understand the role of AHCTF1 in the progression of HCC, we examined the expression of AHCTF1 in several HCC cell lines. The results revealed that Huh7 cells exhibited relatively low endogenous expression of AHCTF1, while HepG2 cells expressed higher baseline levels of AHCTF1 (Fig. 3a). Therefore, Huh7 cells were selected as the overexpression model of AHCTF1, and HepG2 cells were selected as the knockdown model of AHCTF1. This approach was taken to more intuitively observe the effects of AHCTF1 overexpression and knockdown on cell function. The results showed that the protein level of AHCTF1 was significantly higher after 24 h of transient transfection of the overexpressing plasmid compared to the level after 48 h (Fig. 3b). Therefore, a 24-h time frame was selected as the temporal boundary for transient transfection. Then, the siRNA with the most effective knockdown, siR-AHCTF1-3, was selected for further evaluation of its impact on the malignant phenotypes of HCC cells (Fig. 3c). The results demonstrated that overexpression of AHCTF1 promoted the proliferation, migration, invasion, and colony formation of tumor cells (Fig. 3d–f). Conversely, knockdown of AHCTF1 has been observed to significantly inhibit the aforementioned abilities in HCC cells (Fig. 3d–F).
Additionally, as illustrated in Fig. 2, the DEGs identified through varying levels of AHCTF1 expression were primarily enriched in the PI3K-Akt and Hedgehog signaling pathways, as well as in processes related to cell adhesion and glycolysis. These signaling pathways and biological processes have been reported to be closely associated with the epithelial-mesenchymal transition (EMT) pathway [18–20]. Therefore, the impact of AHCTF1 on the EMT pathway was investigated. The results demonstrated that overexpression of AHCTF1 resulted in a reduction in the expression level of E-cadherin and an increase in the expression levels of N-cadherin and Vimentin, indicating that overexpression of AHCTF1 facilitated the EMT pathway. Knockdown of AHCTF1 led to the opposite effect (Fig. 3g). These findings suggested that targeting AHCTF1 could provide an effective means of suppressing the malignant phenotypes and EMT pathway in HCC cells.
AHCTF1 Promoted Tumor Growth and Lung Metastasis in HCC in vivo
To validate the effects of AHCTF1 in vivo, the xenograft tumor models were constructed by subcutaneously injecting Huh7 cells with stable overexpression of ACHTF1 (Fig. 4a) or corresponding control cells (5 × 106 cells/each) into 4-week-old female nude mice (n = 12). Consistent with the results from cell experiments in vitro, overexpression of AHCTF1 could promote tumor growth in vivo, resulting in a significant increase in both tumor volume and weight (Fig. 4b, c). Furthermore, tumor samples with AHCTF1 overexpression exhibited significantly elevated levels of Ki67, reflecting the ability of AHCTF1 to enhance the proliferation of tumor cells (Fig. 4d). To further investigate the role of AHCTF1 in HCC metastasis in vivo, we established a lung metastasis model. The results demonstrated a significant increase in pulmonary metastatic nodules and the disruption of normal structures by overexpression of AHCTF1 (Fig. 5a, b), indicating that AHCTF1 facilitated lung metastasis in HCC. These findings suggested that AHCTF1 acts as an oncogenic factor in HCC in vivo.
In summary, this study demonstrated that AHCTF1 was highly expressed in HCC and positively correlated with a poor prognosis. AHCTF1 facilitated the proliferation, migration, invasion, and EMT process in HCC cells, thereby contributing to tumor growth and metastasis in vivo.
Discussion
Discussion
HCC remains a formidable challenge in the field of oncology, primarily due to its late-stage diagnosis and the limited efficacy of current therapeutic strategies [5, 7]. The identification of novel biomarkers and molecular targets is crucial for the improvement of early detection and treatment outcomes. In this study, we investigated the function of AHCTF1, a nucleoporin, in HCC progression and validated its role in promoting tumor growth of HCC in mice for the first time.
Nucleoporins (Nups) constitute a vital component of the Nuclear Pore Complex (NPC), which is responsible for regulating the exchange of materials between the nucleus and the cytoplasm [21]. Although the conventional function of Nups is to ensure the normal nucleocytoplasmic transport, increasing evidence suggests that they play significant roles in the proliferation, metastasis, and drug resistance of cancer cells [21, 22]. For example, Nup98 and Nup214 are highly expressed in leukemia and multiple myeloma, where they modulate the transport of cell cycle-related proteins, thereby accelerating tumor cell proliferation [23–25]. Nup58 has been demonstrated to facilitate the EMT and metastasis in lung adenocarcinoma through the GSK-3β-Snail axis [26]. Nup62 and Nup88 are highly expressed in head and neck cancers, and Nup62 enhances the stability of Nup88, which activates the NF-κB/p65 pathway and promotes cancer progression [27]. Nup153 promotes the proliferation and migration of tumor cell by the c-Myc/P15 axis in HCC [28]. Nup93 mediates the nuclear import of β-catenin to promote progression and metastasis in HCC [29]. In this study, we provided insights into the pivotal function of AHCTF1 in the advancement of HCC.
AHCTF1, a member of the nucleoporin family, is indispensable for the assembly of the nuclear pore complex (NPC) and mitosis and performs a wide range of activities during the cell cycle, including chromatin compression, mitotic spindle assembly and chromosome segregation [11–13, 30, 31]. Despite the limited research on AHCTF1 in cancer, the few existing studies indicate that these functions of AHCTF1 make it possible to regulate various cellular processes that can influence the development of tumors [14–16]. Our findings revealed that AHCTF1 was markedly upregulated in HCC tissues compared to normal liver tissues. This upregulation was further found to correlate with pivotal clinicopathological characteristics of HCC, notably primary tumor status and clinical stage. There was a positive correlation between AHCTF1 expression and cancer stage progression. Consistent with these observations, patients with elevated AHCTF1 expression exhibited significantly lower overall survival rates, highlighting its potential as a biomarker for poor prognosis in HCC.
The bioinformatics analysis revealed that the DEGs linked to AHCTF1 expression were enriched in critical pathways such as PI3K-Akt and Hedgehog signaling pathways, both of which are well-documented for their roles in cancer development and progression. The PI3K-Akt pathway is widely acknowledged for its involvement in regulating cell proliferation, survival, and migration [32]. Similarly, the Hedgehog pathway has been linked to the maintenance of stem cell populations and tissue regeneration, processes that are frequently dysregulated in tumor cells [33]. The enrichment of DEGs in these pathways suggests that AHCTF1 may exert its oncogenic effects through modulation of these signaling cascades. In addition to signaling pathways, our analysis demonstrated that the DEGs were also involved in cell adhesion and glycolysis. Cell adhesion is crucial for maintaining tissue integrity and is frequently disrupted in cancerous cells, thereby facilitating cell migration and invasion [34]. Glycolysis represents a metabolic pathway that allows tumor cells to satisfy their increased energy requirements, even under hypoxic conditions [35]. The involvement of AHCTF1 in these processes serves to further emphasize its multifaceted role in the progression of HCC.
It has been reported that AHCTF1 was identified as one of the recurrently mutated oncogenes in follicular thyroid cancer (FTC) through whole-exome sequencing (WES) and bioinformatics analysis [15]. In a zebrafish model of HCC, AHCTF1 and Kras mutations has been observed to amplify oncogenic stress while also restricting liver overgrowth [16]. AHCTF1 facilitates the interaction between Nups and the oncogenic superenhancer via the WNT/β-catenin signaling pathway, thereby promoting the expression of oncogenic MYC in colon cancer cells [14]. Furthermore, our work has revealed that AHCTF1 promotes the proliferation, migration, invasion, and EMT in HCC cells, underscoring its contribution to the aggressiveness of HCC. Importantly, we validated for the first time that AHCTF1 significantly promotes tumor growth and metastasis in the HCC xenograft tumor model in mice. This finding is consistent with the in vitro results and further supports the role of AHCTF1 as an oncogenic factor in HCC.
Although the precise molecular mechanisms by which AHCTF1 exerts its effects in HCC remain to be fully elucidated, our study suggests that AHCTF1 may act through key signaling pathways, including PI3K-Akt and Hedgehog. Additionally, AHCTF1 may contribute to the progression of HCC by directly or indirectly interacting with transcriptional regulators involved in EMT and metastasis. Our future research will focus on elucidating the specific molecular interactions between AHCTF1 and these pathways, as well as identifying potential downstream targets of AHCTF1. Besides, due to the current limitations of experimental conditions and time, the construction of the mouse model for AHCTF1 gene knockdown remains incomplete at this stage. Future studies will concentrate on the establishment of a reliable in vivo model to further investigate the functional role of AHCTF1 in this context.
HCC remains a formidable challenge in the field of oncology, primarily due to its late-stage diagnosis and the limited efficacy of current therapeutic strategies [5, 7]. The identification of novel biomarkers and molecular targets is crucial for the improvement of early detection and treatment outcomes. In this study, we investigated the function of AHCTF1, a nucleoporin, in HCC progression and validated its role in promoting tumor growth of HCC in mice for the first time.
Nucleoporins (Nups) constitute a vital component of the Nuclear Pore Complex (NPC), which is responsible for regulating the exchange of materials between the nucleus and the cytoplasm [21]. Although the conventional function of Nups is to ensure the normal nucleocytoplasmic transport, increasing evidence suggests that they play significant roles in the proliferation, metastasis, and drug resistance of cancer cells [21, 22]. For example, Nup98 and Nup214 are highly expressed in leukemia and multiple myeloma, where they modulate the transport of cell cycle-related proteins, thereby accelerating tumor cell proliferation [23–25]. Nup58 has been demonstrated to facilitate the EMT and metastasis in lung adenocarcinoma through the GSK-3β-Snail axis [26]. Nup62 and Nup88 are highly expressed in head and neck cancers, and Nup62 enhances the stability of Nup88, which activates the NF-κB/p65 pathway and promotes cancer progression [27]. Nup153 promotes the proliferation and migration of tumor cell by the c-Myc/P15 axis in HCC [28]. Nup93 mediates the nuclear import of β-catenin to promote progression and metastasis in HCC [29]. In this study, we provided insights into the pivotal function of AHCTF1 in the advancement of HCC.
AHCTF1, a member of the nucleoporin family, is indispensable for the assembly of the nuclear pore complex (NPC) and mitosis and performs a wide range of activities during the cell cycle, including chromatin compression, mitotic spindle assembly and chromosome segregation [11–13, 30, 31]. Despite the limited research on AHCTF1 in cancer, the few existing studies indicate that these functions of AHCTF1 make it possible to regulate various cellular processes that can influence the development of tumors [14–16]. Our findings revealed that AHCTF1 was markedly upregulated in HCC tissues compared to normal liver tissues. This upregulation was further found to correlate with pivotal clinicopathological characteristics of HCC, notably primary tumor status and clinical stage. There was a positive correlation between AHCTF1 expression and cancer stage progression. Consistent with these observations, patients with elevated AHCTF1 expression exhibited significantly lower overall survival rates, highlighting its potential as a biomarker for poor prognosis in HCC.
The bioinformatics analysis revealed that the DEGs linked to AHCTF1 expression were enriched in critical pathways such as PI3K-Akt and Hedgehog signaling pathways, both of which are well-documented for their roles in cancer development and progression. The PI3K-Akt pathway is widely acknowledged for its involvement in regulating cell proliferation, survival, and migration [32]. Similarly, the Hedgehog pathway has been linked to the maintenance of stem cell populations and tissue regeneration, processes that are frequently dysregulated in tumor cells [33]. The enrichment of DEGs in these pathways suggests that AHCTF1 may exert its oncogenic effects through modulation of these signaling cascades. In addition to signaling pathways, our analysis demonstrated that the DEGs were also involved in cell adhesion and glycolysis. Cell adhesion is crucial for maintaining tissue integrity and is frequently disrupted in cancerous cells, thereby facilitating cell migration and invasion [34]. Glycolysis represents a metabolic pathway that allows tumor cells to satisfy their increased energy requirements, even under hypoxic conditions [35]. The involvement of AHCTF1 in these processes serves to further emphasize its multifaceted role in the progression of HCC.
It has been reported that AHCTF1 was identified as one of the recurrently mutated oncogenes in follicular thyroid cancer (FTC) through whole-exome sequencing (WES) and bioinformatics analysis [15]. In a zebrafish model of HCC, AHCTF1 and Kras mutations has been observed to amplify oncogenic stress while also restricting liver overgrowth [16]. AHCTF1 facilitates the interaction between Nups and the oncogenic superenhancer via the WNT/β-catenin signaling pathway, thereby promoting the expression of oncogenic MYC in colon cancer cells [14]. Furthermore, our work has revealed that AHCTF1 promotes the proliferation, migration, invasion, and EMT in HCC cells, underscoring its contribution to the aggressiveness of HCC. Importantly, we validated for the first time that AHCTF1 significantly promotes tumor growth and metastasis in the HCC xenograft tumor model in mice. This finding is consistent with the in vitro results and further supports the role of AHCTF1 as an oncogenic factor in HCC.
Although the precise molecular mechanisms by which AHCTF1 exerts its effects in HCC remain to be fully elucidated, our study suggests that AHCTF1 may act through key signaling pathways, including PI3K-Akt and Hedgehog. Additionally, AHCTF1 may contribute to the progression of HCC by directly or indirectly interacting with transcriptional regulators involved in EMT and metastasis. Our future research will focus on elucidating the specific molecular interactions between AHCTF1 and these pathways, as well as identifying potential downstream targets of AHCTF1. Besides, due to the current limitations of experimental conditions and time, the construction of the mouse model for AHCTF1 gene knockdown remains incomplete at this stage. Future studies will concentrate on the establishment of a reliable in vivo model to further investigate the functional role of AHCTF1 in this context.
Conclusion
Conclusion
In conclusion, this study has revealed the upregulation of AHCTF1 in HCC tissues and its association with poor prognosis, suggesting that AHCTF1 may serve as a valuable biomarker for predicting clinical outcomes in HCC patients. AHCTF1 acts as a potential oncogenic factor by enhancing the proliferation, migration, invasion, and EMT process of HCC cells, thereby contributing to tumor growth and metastasis in vivo. These findings not only enhance our comprehension of the role of AHCTF1 in HCC but also highlight AHCTF1 as a promising target for future therapeutic interventions. Future studies are necessary to further elucidate the mechanisms by which AHCTF1 exerts its regulatory functions and to explore the therapeutic potential of targeting AHCTF1 in HCC.
In conclusion, this study has revealed the upregulation of AHCTF1 in HCC tissues and its association with poor prognosis, suggesting that AHCTF1 may serve as a valuable biomarker for predicting clinical outcomes in HCC patients. AHCTF1 acts as a potential oncogenic factor by enhancing the proliferation, migration, invasion, and EMT process of HCC cells, thereby contributing to tumor growth and metastasis in vivo. These findings not only enhance our comprehension of the role of AHCTF1 in HCC but also highlight AHCTF1 as a promising target for future therapeutic interventions. Future studies are necessary to further elucidate the mechanisms by which AHCTF1 exerts its regulatory functions and to explore the therapeutic potential of targeting AHCTF1 in HCC.
Supplementary Information
Supplementary Information
Below is the link to the electronic supplementary material.
Below is the link to the electronic supplementary material.
출처: PubMed Central (JATS). 라이선스는 원 publisher 정책을 따릅니다 — 인용 시 원문을 표기해 주세요.
🏷️ 같은 키워드 · 무료전문 — 이 논문 MeSH/keyword 기반
- A Phase I Study of Hydroxychloroquine and Suba-Itraconazole in Men with Biochemical Relapse of Prostate Cancer (HITMAN-PC): Dose Escalation Results.
- Self-management of male urinary symptoms: qualitative findings from a primary care trial.
- Clinical and Liquid Biomarkers of 20-Year Prostate Cancer Risk in Men Aged 45 to 70 Years.
- Diagnostic accuracy of Ga-PSMA PET/CT versus multiparametric MRI for preoperative pelvic invasion in the patients with prostate cancer.
- Comprehensive analysis of androgen receptor splice variant target gene expression in prostate cancer.
- Clinical Presentation and Outcomes of Patients Undergoing Surgery for Thyroid Cancer.