Enhancer activation from transposable elements in extrachromosomal DNA.
1/5 보강
Extrachromosomal DNA (ecDNA) drives oncogene amplification and intratumoural heterogeneity in aggressive cancers.
APA
Kraft K, Murphy SE, et al. (2025). Enhancer activation from transposable elements in extrachromosomal DNA.. Nature cell biology, 27(11), 1914-1924. https://doi.org/10.1038/s41556-025-01788-6
MLA
Kraft K, et al.. "Enhancer activation from transposable elements in extrachromosomal DNA.." Nature cell biology, vol. 27, no. 11, 2025, pp. 1914-1924.
PMID
41120733 ↗
Abstract 한글 요약
Extrachromosomal DNA (ecDNA) drives oncogene amplification and intratumoural heterogeneity in aggressive cancers. While transposable element reactivation is common in cancer, its role on ecDNA remains unexplored. Here we map the 3D architecture of MYC-amplified ecDNA in colorectal cancer cells and identify 68 ecDNA-interacting elements-genomic loci enriched for transposable elements that are frequently integrated onto ecDNA. We focus on an L1M4a1#LINE/L1 fragment co-amplified with MYC, which functions only in the ecDNA-amplified context. Using CRISPR-CATCH, CRISPR interference and reporter assays, we confirm its presence on ecDNA, enhancer activity and essentiality for cancer cell fitness. These findings reveal that repetitive elements can be reactivated and co-opted as functional rather than inactive sequences on ecDNA, potentially driving oncogene expression and tumour evolution. Our study uncovers a mechanism by which ecDNA harnesses repetitive elements to shape cancer phenotypes, with implications for diagnosis and therapy.
🏷️ 키워드 / MeSH 📖 같은 키워드 OA만
📖 전문 본문 읽기 PMC JATS · ~78 KB · 영문
Main
Main
Extrachromosomal DNA (ecDNA) is a prevalent form of oncogene amplification present in approximately 15% of cancers at diagnosis1–5. ecDNAs are megabase-scale, circular DNA elements lacking centromeric and telomeric sequences and found as distinct foci apart from chromosomal DNA6. Recent work has underscored the importance of ecDNA in tumour initiation and various aspects of tumour progression, such as accelerating intratumoural heterogeneity, genomic dysregulation and therapeutic resistance7–11. The biogenesis of ecDNA is complex and tied to mechanisms that induce genomic instability, such as chromothripsis and breakage–fusion–bridge cycles, which are prevalent in tumour cells6,12–17.
A key aspect of ecDNA function is their ability to hijack cis-regulatory elements that increase oncogene expression beyond the constraints imposed by endogenous chromosomal architecture18–23. Consequently, their nuclear organization is tightly tied to their ability to amplify gene expression18,20. Likewise, repetitive genomic elements provide a vast network of cryptic promoters or enhancers capable of rewiring gene regulatory networks for proto-oncogene expression—including long-range gene regulation24–26. By investigating the three-dimensional (3D) organization of ecDNA, we identified an enrichment of repetitive elements associated with ecDNA structural variation, which we classify as ecDNA-interacting elements (EIEs). We found that insertion of a particular EIE containing a fragment of an ancient L1M4a1 LINE within ecDNA leads to expression of said element that is critical for cancer cell fitness. Our data reveal a relationship between the presence of specific repetitive elements and aberrant expression of oncogenes on ecDNA.
Extrachromosomal DNA (ecDNA) is a prevalent form of oncogene amplification present in approximately 15% of cancers at diagnosis1–5. ecDNAs are megabase-scale, circular DNA elements lacking centromeric and telomeric sequences and found as distinct foci apart from chromosomal DNA6. Recent work has underscored the importance of ecDNA in tumour initiation and various aspects of tumour progression, such as accelerating intratumoural heterogeneity, genomic dysregulation and therapeutic resistance7–11. The biogenesis of ecDNA is complex and tied to mechanisms that induce genomic instability, such as chromothripsis and breakage–fusion–bridge cycles, which are prevalent in tumour cells6,12–17.
A key aspect of ecDNA function is their ability to hijack cis-regulatory elements that increase oncogene expression beyond the constraints imposed by endogenous chromosomal architecture18–23. Consequently, their nuclear organization is tightly tied to their ability to amplify gene expression18,20. Likewise, repetitive genomic elements provide a vast network of cryptic promoters or enhancers capable of rewiring gene regulatory networks for proto-oncogene expression—including long-range gene regulation24–26. By investigating the three-dimensional (3D) organization of ecDNA, we identified an enrichment of repetitive elements associated with ecDNA structural variation, which we classify as ecDNA-interacting elements (EIEs). We found that insertion of a particular EIE containing a fragment of an ancient L1M4a1 LINE within ecDNA leads to expression of said element that is critical for cancer cell fitness. Our data reveal a relationship between the presence of specific repetitive elements and aberrant expression of oncogenes on ecDNA.
Results
Results
ecDNA structural variants enriched for repetitive element insertions
To interrogate the conformational state of ecDNA, we performed Hi-C on COLO320DM colorectal cancer cells (Fig. 1a). Previous investigation of COLO320DM utilizing DNA fluorescent in situ hybridization (FISH) and whole-genome sequencing identified a highly rearranged (up to 4.3 MB) ecDNA amplification containing several genes, including the oncogene MYC and the long non-coding RNA PVT118,20. As a large fraction of the ecDNA in COLO320DM is derived from chromosome 8, with smaller contributions from chromosomes 6, 16 and 13, we elected to focus on the chromosome-8-amplified locus containing MYC and PVT120.
Analysis of the Hi-C maps identified 68 interactions between the chromosome-8-amplified ecDNA locus and other chromosomes that displayed a striking pattern (Fig. 1b and Supplementary Table 1). By binning the data at 1 kb resolution, we found that linear elements in the genome contacted the entirety of the megabase-scale ecDNA amplification in a distinctive stripe (Fig. 1b,c). These contacts were spread across all chromosomes in the genome (Supplementary Table 1). This atypical interaction pattern suggested a complex structural relationship between the chromosome-8-amplified ecDNA and the endogenous chromosome regions (Fig. 1b,c). Further inspection revealed these genomic interactions were enriched for transposable elements (TEs) annotated as LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements) and LTRs (long terminal repeats (Fig. 1d, Extended Data Fig. 1a and Supplementary Tables 2 and 3). As these retrotransposons can acquire the ability to regulate transcription when active, we reasoned that the spatial relationship with oncogenes such as MYC may be important for enhanced expression in COLO320DM cells27,28. We hereafter refer to these 1-kb interactions, often containing retrotransposons, as EIEs.
While Hi-C is widely used to map genome-wide chromatin interactions, it can also be repurposed to identify structural variants, including rearrangements that are hallmarks of cancer genomes29,30. We considered that the atypical striping pattern observed in our Hi-C data was probably the result of structural variation either within the COLO320 genome or due to the insertion of repetitive elements into ecDNA. To discern between these two possibilities, we performed long-read nanopore sequencing (Methods). We chose long-read sequencing to also capture potential heterogeneity in insertion sites in the case of single or multiple integrations (Fig. 1e,f; Methods). We generated median read lengths of 67,000 bp, with the longest read spanning 684,457 bases. Across the 68 EIEs identified, we determined that each participated in a broad spectrum of structural variation—some involved with hundreds or thousands of different rearrangement events (Extended Data Fig. 1b; Methods).
EIE 14 is a ‘passenger’ on MYC ecDNA
After confirming that the identified EIEs were associated with structural rearrangements, we next investigated the overlap between ecDNA and EIE rearrangements. We first reconstructed ecDNA utilizing the CoRAL algorithm31, a pipeline that leverages long-read data to accurately infer a set of ecDNAs from the breakpoints (that is, structural variation) associated with amplified regions of the genome (Methods). We found that reads containing EIEs often overlapped ecDNA intervals with greater coverage than expected based on the average genome coverage of our dataset (approximately 12.1), suggesting that these EIEs are present in at least a subset of ecDNA amplifications (Fig. 1e,f). We further investigated CoRAL’s reconstruction of COLO320DM’s complex and heterogeneous MYC-containing amplicon and identified a high-confidence breakpoint connecting a chromosome-3-amplified EIE (EIE 14) to an intergenic region between CASC8 and MYC on the chromosome 8 amplification (Fig. 1g; Methods).
We selected this EIE (EIE 14) for further characterization of EIE biology owing to its proximity to MYC on the ecDNA and because it contains a segment with homology to L1M4a1, an ancient element distantly related to LINE-1. The percentage of nucleotide conservation of this segment to the L1M4a1 consensus sequence is consistent with L1M4a1’s Kimura divergence value of 34%. We reasoned that this degree of sequence divergence would allow us to specifically target and interrogate its function without unintentionally targeting other repetitive elements in the genome. We also identified a fragment of LINE-1 PA2 and an ORF2-like protein on EIE 1432,33 (Extended Data Fig. 1c,d). Although the mechanism generating the adjacency of the fragments remains uncertain, the L1M4a1-like segment harbours a polyA-signal-like motif (AAAAAG), supporting a model in which an L1PA2 transcript reads through its own 3′ end and terminates at this neighbouring signal, producing a 3′-transduced RNA that could be mobilized in trans by the LINE-1 enzyme32,33 (Extended Data Fig. 1c,d).
To confirm the computational reconstruction of the ecDNA and the heterogeneity of different ecDNA molecules, we turned to CRISPR-CATCH (Cas9-assisted targeting of chromosome segments)—a method for isolating and sequencing ecDNA—to elucidate the size and variations of ecDNAs containing EIE 1422 (Fig. 2a). Targeting EIE 14 with two independent gRNAs, we successfully isolated ecDNA fragments from the COLO320DM cell line for sequencing (Fig. 2b). Sequence analysis of these bands confirmed the presence of EIE 14, originally annotated on chromosome 3, to be inserted onto chromosome 8 between the CASC8 and CASC11 genes approximately 200 kilobases away from MYC, in agreement with the long-read nanopore sequencing (Figs. 1g and 2c, Extended Data Fig. 2a,b and Supplementary Tables 4–6). Multiple bands of different sizes on the pulsed-field gel electrophoresis (PFGE) gel indicated the presence of varying sizes of ecDNAs, all sharing the EIE 14 insertion within the chromosome 8 amplicon (Fig. 2b,c). Beyond EIE 14, the CRISPR-CATCH approach allowed us to capture and sequence a subset of EIEs initially identified through Hi-C analysis (Fig. 2d). The identification of the additional EIEs observed in the Hi-C data suggest that the ‘striping’ between the ecDNA and endogenous chromosomes is an artefact of these sequences’ presence on ecDNAs, rather than true trans contacts, at least for this identified subset. Although the recent T2T genome build34 annotates EIE 14 to chromosome 3 (Extended Data Fig. 2c), we found evidence that the structural variant described here between EIE 14 and the MYC-containing amplicon region is identified as a translocation event between Chr8:128,533,830 and Chr3:111,274,086 in approximately 46% (minor allele frequency of 0.467646) of individuals without disease35 (Supplementary Table 4, row 7). This suggests that this structural variant was preexisting before cancer formation in the COLO320-originating patient and was subsequently amplified as a passenger on ecDNA.
EIE 14 makes frequent contact with MYC
We then utilized Optical Reconstruction of Chromatin Architecture (ORCA) to quantify the spatial relationship of EIE 14 with MYC36,37 (Fig. 2e). Barcoded probes were designed targeting the unique portion of EIE 14 (1 kb), MYC exon 2 (3.1 kb), PVT1 exon 1 (2.5 kb) and the endogenous chromosome 3 region flanking EIE 14 (3 kb) (Supplementary Table 7) to determine the spatial organization of EIE 14 relative to the ecDNA. These specific exons were chosen to account for the fact that amplicon reconstruction of ecDNA in the COLO320DM cell line demonstrated an occasional rearrangement of MYC exon 2 replacement by PVT1 exon 1 (ref. 20). Because EIE 14 is classified as a repetitive element, we confirmed probe specificity by staining the EIE 14 locus in K562 cells that do not contain ecDNA. Indeed, we detect only one to three labelled regions in the non-amplified context (Extended Data Fig. 3a). By contrast, when labelling COLO320DM cells, EIE 14 colocalized with the ecDNA and amplified to a similar copy number per cell (Fig. 2e and Extended Data Fig. 3b). The extensive structural variation detected in the long-read sequencing and the amplification of EIE 14 visualized by ORCA (Extended Data Fig. 3b) suggest a model in which the element resides in the sequence amplified on ecDNA and participates in cis and/or trans contacts with other ecDNA molecules.
It has been proposed that amplified loci within ecDNA are able to regulate oncogene expression through cis interactions on the same ecDNA molecule as well as trans interactions between ecDNAs via a clustering mechanism20. As such, it is important to understand not only the structural variations of ecDNA, but also their spatial organization within the nucleus to gain a comprehensive understanding of their potential regulatory functions. We quantified the spatial distributions of MYC exon 2, PVT1 exon 1 and EIE 14; the imaged loci were fitted in three dimensions with a Gaussian fitting algorithm to extract x,y,z coordinates (Fig. 3a–c; Methods). The copy number of identified loci varied from zero detected points to 150 per cell. On average, MYC had 29, PVT1 had 31 and EIE 14 had 22 copies per cell (Extended Data Fig. 3b). Similar distributions of points per cell, as well as strong correlation (r > 0.7) between the number of points per loci per cell (Extended Data Fig. 3c), suggest that this EIE is not inserted into multiple sites on a single ecDNA.
Once the centroids of each point per cell were identified (Fig. 3c), we calculated the all-to-all pairwise distance relationship (Fig. 3d). The off-diagonal pattern of distances between EIE 14, MYC and PVT1 suggested a tendency for these loci to cluster at genomic distances <1,000 nm. We further quantified the spatial relationships across all 1,329 imaged cells by calculating the shortest pairwise distances between the three loci. To determine if these ecDNA molecules were spatially clustering in cells, we leveraged our observation that each ecDNA molecule carries a single copy of MYC and EIE 14. Thus, distances between MYC and other MYC loci should be closer than random if the ecDNA were spatially clustered. Random distances were simulated in a sphere with the identical number of points per a given cell. The distribution of shortest pairwise distances between MYC and MYC and between EIE 14 and EIE 14 were left-shifted compared with the randomly simulated points, suggesting a non-random organization (Fig. 3e,f, P < 1 × 10−10). The median observed versus expected distances between each EIE 14 loci were 748 nm and 927 nm, respectively, and the median observed versus expected distances between each MYC loci were 707 nm and 814 nm, respectively.
Previous work has proposed that enhancers can exert transcriptional regulation on promoters at a distance of up to 300 nm via accumulation of activating factors38–41. To determine whether EIE 14 and MYC are within this regulatory distance range on ecDNA molecules, we calculated the pairwise distances between loci. Although the median distances between MYC and EIE 14 (797 nm) and PVT1 (585 nm) were greater than 300 nm, 12% and 20% of these loci, respectively, were within the regulatory range of MYC (Extended Data Fig. 3d,e).
To investigate the spatial relationship between EIE 14 and MYC while controlling for locus density, we calculated the degree of spatial clustering across distance intervals using Ripley’s K spatial point pattern analysis (Methods; Fig. 3g). MYC exhibited the strongest clustering with EIE 14 at distances less than 200 nm (K value >1), and this behaviour approached a random distribution at greater distances (K value ~1; Fig. 3g,h). On average, the distances between MYC and EIE 14 were greater than those between MYC and PVT1. However, at distances below 300 nm, EIE 14 and PVT1 displayed similar clustering behaviour with MYC (Fig. 3h and Extended Data Fig. 3d,e). This clustering suggests that EIE 14 is acting as a proximity-dependent regulator of MYC reminiscent of enhancer–promoter interactions42. Altogether, the spatial clustering behaviour of this ecDNA species measured here and previously20, the propensity for MYC to engage in ‘enhancer hijacking’43 and the ability of reactivated repetitive elements to engage in long-range gene activation27 suggest that any genomically linear separation of MYC and EIE 14 is overcome in both cis (interaction with MYC on the same ecDNA molecule) and trans (ecDNA–ecDNA interactions).
EIE 14 is critical for cancer cell fitness and displays enhancer activity
To test whether the identified TEs are important for the cancer cell proliferation, we performed a CRISPR interference (CRISPRi) growth screen targeting a subset of EIEs in COLO320DM cells engineered to stably express dCas9-KRAB44 (Fig. 4a,b). We were able to target 36 out of the 68 EIEs with single guide RNAs (sgRNAs) that met the following criteria: (1) must meet stringent specificity criteria to reduce potential off targets intrinsic to repetitive sequences (Methods) and (2) have at least two sgRNAs per EIE. We also included 125 non-targeting controls (NTC) that were introduced into cells with the EIE sgRNAs via lentiviral transduction (Supplementary Table 10). After transduction, we monitored cell proliferation at multiple timepoints: 4 days (baseline), 3 days after baseline, 14 days and 1 month (30 days), followed by deep sequencing to quantify sgRNA frequencies (Fig. 4b). We obtained highly reproducible guide counts across replicates and timepoints (Extended Data Fig. 4b,c).
Our data showed that the growth phenotype curve for 3 out of 36 of our targeted EIEs at various timepoints indicated a Z score of less than −1, which suggested a significant negative impact on cell viability, with an acute growth defect after only 3 days (Fig. 4b, Extended Data Fig. 4 and Supplementary Tables 8 and 9). These elements were categorized as evolutionarily older based on their retrotransposition activity in the human genome and spanned classes (LINEs, SINEs and LTRs) (Supplementary Table 11). The enrichment of old TEs may be confounded by the relative ease of targeting sequences with increased sequence divergence. They are generally found in gene-poor regions, making it unlikely that silencing would lead to secondary effects from heterochromatin spreading. Collectively, these results suggest that a subset of our targeted EIEs, including EIE 14, can contribute to cancer cell growth and fitness. We speculate that this is related to EIE interaction with MYC, as knockdown of this oncogene has been shown to have similar effects on COLO320DM growth and survival45,46. In addition, 3 out of 36 of the measured EIEs also had a Z score greater than 1, indicating a significant increase of cell growth or fitness. The identity of these elements also spanned multiple element classes, with two (EIE 68 and EIE 45) located within uncharacterized non-coding RNAs, and one (EIE 57) within the first exon of the ANKRD30B protein-coding gene, which has been implicated in cell proliferation47. Further investigation of these hits is warranted in future studies to explain their positive effects on cell growth, especially those within the uncharacterized non-coding RNA regions.
The strongest growth defect was observed for perturbation of EIE 14 (Fig. 4b), which when combined with our finding of its co-localization with ecDNA-amplified MYC (Fig. 3h), suggests a potential enhancer-like regulatory role for this EIE. To examine the epigenetic landscape of this element we leveraged copy-number-normalized chromatin immunoprecipitation sequencing (ChIP-seq) measuring H3 lysine 27 acetylation (H3K27ac), BRD4 occupancy and assay for transposase-accessible chromatin using sequencing (ATAC-seq) accessibility data. These epigenetic features are all commonly associated with enhancer activity18,48,49. Notably, many EIEs, including EIE 14, were accessible in COLO320DM cells (Fig. 4c,d and Extended Data Fig. 5). The measured accessibility of EIE 14 contrasts the normally silenced H3 lysine 9 trimethylation (H3k9me3) state across annotated human cell lines50,51 (Fig. 4e). Cross-referencing our identified EIEs with accessibility data from other ecDNA-containing cell lines demonstrated that accessibility of EIEs is a more generalizable phenomenon beyond COLO320DM cells (Extended Data Fig. 5). Altogether, the accessibility and proximal clustering of EIE 14 points towards active regulatory potential of this element in COLO320DM cells, while identification of accessible EIEs across cell lines suggests a broader functional relevance of EIE regulatory potential on ecDNA48,49 (Extended Data Fig. 5).
To determine whether EIE 14 activity is a consequence of ecDNA formation, we performed RNA-FISH on the sequence-specific 1-kb segment of EIE 14 in COLO320DM and isogenic COLO320HSR cells. The homogeneously staining region (HSR) cell line contains a similar copy number amplification of the MYC-amplified portion of chromosome 8, but the majority of these copies have integrated into chromosomes18 (Fig. 5a). We reasoned that, if the unique extrachromosomal context of ecDNA facilitates activation of EIE 14, we should not see evidence of its activity in the COLO320HSR genome-integrated context. Indeed, we observed distinct transcription events in the COLO320DM line (median n = 8 transcripts per cell) but not in the HSR line(median n = 0 transcripts per cell; Fig. 5b and Extended Data Fig. 6a,b).
Finally, to directly test the ability for the EIE 14 sequence to act as an enhancer of MYC expression, we performed a luciferase reporter assay measuring its ability to activate transcription of TK and MYC promoters20,52 (Fig. 5c). EIE 14 significantly increased MYC promoter-mediated reporter gene expression relative to the promoter-only control, signifying bona fide enhancer activity (Fig. 5c). Separating EIE 14 into L1M4a1 and L1PA2 fragments further demonstrated that both sequences can individually act as enhancers, with an additive effect when combined (Extended Data Fig. 6c). In sum, the enhancer-associated features and regulatory activity of the luciferase assay suggested that EIE 14, and possibly other EIEs, have been co-opted as regulatory sequences when found on ecDNA, influencing the expression of ecDNA-borne oncogenes (Fig. 5d).
ecDNA structural variants enriched for repetitive element insertions
To interrogate the conformational state of ecDNA, we performed Hi-C on COLO320DM colorectal cancer cells (Fig. 1a). Previous investigation of COLO320DM utilizing DNA fluorescent in situ hybridization (FISH) and whole-genome sequencing identified a highly rearranged (up to 4.3 MB) ecDNA amplification containing several genes, including the oncogene MYC and the long non-coding RNA PVT118,20. As a large fraction of the ecDNA in COLO320DM is derived from chromosome 8, with smaller contributions from chromosomes 6, 16 and 13, we elected to focus on the chromosome-8-amplified locus containing MYC and PVT120.
Analysis of the Hi-C maps identified 68 interactions between the chromosome-8-amplified ecDNA locus and other chromosomes that displayed a striking pattern (Fig. 1b and Supplementary Table 1). By binning the data at 1 kb resolution, we found that linear elements in the genome contacted the entirety of the megabase-scale ecDNA amplification in a distinctive stripe (Fig. 1b,c). These contacts were spread across all chromosomes in the genome (Supplementary Table 1). This atypical interaction pattern suggested a complex structural relationship between the chromosome-8-amplified ecDNA and the endogenous chromosome regions (Fig. 1b,c). Further inspection revealed these genomic interactions were enriched for transposable elements (TEs) annotated as LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements) and LTRs (long terminal repeats (Fig. 1d, Extended Data Fig. 1a and Supplementary Tables 2 and 3). As these retrotransposons can acquire the ability to regulate transcription when active, we reasoned that the spatial relationship with oncogenes such as MYC may be important for enhanced expression in COLO320DM cells27,28. We hereafter refer to these 1-kb interactions, often containing retrotransposons, as EIEs.
While Hi-C is widely used to map genome-wide chromatin interactions, it can also be repurposed to identify structural variants, including rearrangements that are hallmarks of cancer genomes29,30. We considered that the atypical striping pattern observed in our Hi-C data was probably the result of structural variation either within the COLO320 genome or due to the insertion of repetitive elements into ecDNA. To discern between these two possibilities, we performed long-read nanopore sequencing (Methods). We chose long-read sequencing to also capture potential heterogeneity in insertion sites in the case of single or multiple integrations (Fig. 1e,f; Methods). We generated median read lengths of 67,000 bp, with the longest read spanning 684,457 bases. Across the 68 EIEs identified, we determined that each participated in a broad spectrum of structural variation—some involved with hundreds or thousands of different rearrangement events (Extended Data Fig. 1b; Methods).
EIE 14 is a ‘passenger’ on MYC ecDNA
After confirming that the identified EIEs were associated with structural rearrangements, we next investigated the overlap between ecDNA and EIE rearrangements. We first reconstructed ecDNA utilizing the CoRAL algorithm31, a pipeline that leverages long-read data to accurately infer a set of ecDNAs from the breakpoints (that is, structural variation) associated with amplified regions of the genome (Methods). We found that reads containing EIEs often overlapped ecDNA intervals with greater coverage than expected based on the average genome coverage of our dataset (approximately 12.1), suggesting that these EIEs are present in at least a subset of ecDNA amplifications (Fig. 1e,f). We further investigated CoRAL’s reconstruction of COLO320DM’s complex and heterogeneous MYC-containing amplicon and identified a high-confidence breakpoint connecting a chromosome-3-amplified EIE (EIE 14) to an intergenic region between CASC8 and MYC on the chromosome 8 amplification (Fig. 1g; Methods).
We selected this EIE (EIE 14) for further characterization of EIE biology owing to its proximity to MYC on the ecDNA and because it contains a segment with homology to L1M4a1, an ancient element distantly related to LINE-1. The percentage of nucleotide conservation of this segment to the L1M4a1 consensus sequence is consistent with L1M4a1’s Kimura divergence value of 34%. We reasoned that this degree of sequence divergence would allow us to specifically target and interrogate its function without unintentionally targeting other repetitive elements in the genome. We also identified a fragment of LINE-1 PA2 and an ORF2-like protein on EIE 1432,33 (Extended Data Fig. 1c,d). Although the mechanism generating the adjacency of the fragments remains uncertain, the L1M4a1-like segment harbours a polyA-signal-like motif (AAAAAG), supporting a model in which an L1PA2 transcript reads through its own 3′ end and terminates at this neighbouring signal, producing a 3′-transduced RNA that could be mobilized in trans by the LINE-1 enzyme32,33 (Extended Data Fig. 1c,d).
To confirm the computational reconstruction of the ecDNA and the heterogeneity of different ecDNA molecules, we turned to CRISPR-CATCH (Cas9-assisted targeting of chromosome segments)—a method for isolating and sequencing ecDNA—to elucidate the size and variations of ecDNAs containing EIE 1422 (Fig. 2a). Targeting EIE 14 with two independent gRNAs, we successfully isolated ecDNA fragments from the COLO320DM cell line for sequencing (Fig. 2b). Sequence analysis of these bands confirmed the presence of EIE 14, originally annotated on chromosome 3, to be inserted onto chromosome 8 between the CASC8 and CASC11 genes approximately 200 kilobases away from MYC, in agreement with the long-read nanopore sequencing (Figs. 1g and 2c, Extended Data Fig. 2a,b and Supplementary Tables 4–6). Multiple bands of different sizes on the pulsed-field gel electrophoresis (PFGE) gel indicated the presence of varying sizes of ecDNAs, all sharing the EIE 14 insertion within the chromosome 8 amplicon (Fig. 2b,c). Beyond EIE 14, the CRISPR-CATCH approach allowed us to capture and sequence a subset of EIEs initially identified through Hi-C analysis (Fig. 2d). The identification of the additional EIEs observed in the Hi-C data suggest that the ‘striping’ between the ecDNA and endogenous chromosomes is an artefact of these sequences’ presence on ecDNAs, rather than true trans contacts, at least for this identified subset. Although the recent T2T genome build34 annotates EIE 14 to chromosome 3 (Extended Data Fig. 2c), we found evidence that the structural variant described here between EIE 14 and the MYC-containing amplicon region is identified as a translocation event between Chr8:128,533,830 and Chr3:111,274,086 in approximately 46% (minor allele frequency of 0.467646) of individuals without disease35 (Supplementary Table 4, row 7). This suggests that this structural variant was preexisting before cancer formation in the COLO320-originating patient and was subsequently amplified as a passenger on ecDNA.
EIE 14 makes frequent contact with MYC
We then utilized Optical Reconstruction of Chromatin Architecture (ORCA) to quantify the spatial relationship of EIE 14 with MYC36,37 (Fig. 2e). Barcoded probes were designed targeting the unique portion of EIE 14 (1 kb), MYC exon 2 (3.1 kb), PVT1 exon 1 (2.5 kb) and the endogenous chromosome 3 region flanking EIE 14 (3 kb) (Supplementary Table 7) to determine the spatial organization of EIE 14 relative to the ecDNA. These specific exons were chosen to account for the fact that amplicon reconstruction of ecDNA in the COLO320DM cell line demonstrated an occasional rearrangement of MYC exon 2 replacement by PVT1 exon 1 (ref. 20). Because EIE 14 is classified as a repetitive element, we confirmed probe specificity by staining the EIE 14 locus in K562 cells that do not contain ecDNA. Indeed, we detect only one to three labelled regions in the non-amplified context (Extended Data Fig. 3a). By contrast, when labelling COLO320DM cells, EIE 14 colocalized with the ecDNA and amplified to a similar copy number per cell (Fig. 2e and Extended Data Fig. 3b). The extensive structural variation detected in the long-read sequencing and the amplification of EIE 14 visualized by ORCA (Extended Data Fig. 3b) suggest a model in which the element resides in the sequence amplified on ecDNA and participates in cis and/or trans contacts with other ecDNA molecules.
It has been proposed that amplified loci within ecDNA are able to regulate oncogene expression through cis interactions on the same ecDNA molecule as well as trans interactions between ecDNAs via a clustering mechanism20. As such, it is important to understand not only the structural variations of ecDNA, but also their spatial organization within the nucleus to gain a comprehensive understanding of their potential regulatory functions. We quantified the spatial distributions of MYC exon 2, PVT1 exon 1 and EIE 14; the imaged loci were fitted in three dimensions with a Gaussian fitting algorithm to extract x,y,z coordinates (Fig. 3a–c; Methods). The copy number of identified loci varied from zero detected points to 150 per cell. On average, MYC had 29, PVT1 had 31 and EIE 14 had 22 copies per cell (Extended Data Fig. 3b). Similar distributions of points per cell, as well as strong correlation (r > 0.7) between the number of points per loci per cell (Extended Data Fig. 3c), suggest that this EIE is not inserted into multiple sites on a single ecDNA.
Once the centroids of each point per cell were identified (Fig. 3c), we calculated the all-to-all pairwise distance relationship (Fig. 3d). The off-diagonal pattern of distances between EIE 14, MYC and PVT1 suggested a tendency for these loci to cluster at genomic distances <1,000 nm. We further quantified the spatial relationships across all 1,329 imaged cells by calculating the shortest pairwise distances between the three loci. To determine if these ecDNA molecules were spatially clustering in cells, we leveraged our observation that each ecDNA molecule carries a single copy of MYC and EIE 14. Thus, distances between MYC and other MYC loci should be closer than random if the ecDNA were spatially clustered. Random distances were simulated in a sphere with the identical number of points per a given cell. The distribution of shortest pairwise distances between MYC and MYC and between EIE 14 and EIE 14 were left-shifted compared with the randomly simulated points, suggesting a non-random organization (Fig. 3e,f, P < 1 × 10−10). The median observed versus expected distances between each EIE 14 loci were 748 nm and 927 nm, respectively, and the median observed versus expected distances between each MYC loci were 707 nm and 814 nm, respectively.
Previous work has proposed that enhancers can exert transcriptional regulation on promoters at a distance of up to 300 nm via accumulation of activating factors38–41. To determine whether EIE 14 and MYC are within this regulatory distance range on ecDNA molecules, we calculated the pairwise distances between loci. Although the median distances between MYC and EIE 14 (797 nm) and PVT1 (585 nm) were greater than 300 nm, 12% and 20% of these loci, respectively, were within the regulatory range of MYC (Extended Data Fig. 3d,e).
To investigate the spatial relationship between EIE 14 and MYC while controlling for locus density, we calculated the degree of spatial clustering across distance intervals using Ripley’s K spatial point pattern analysis (Methods; Fig. 3g). MYC exhibited the strongest clustering with EIE 14 at distances less than 200 nm (K value >1), and this behaviour approached a random distribution at greater distances (K value ~1; Fig. 3g,h). On average, the distances between MYC and EIE 14 were greater than those between MYC and PVT1. However, at distances below 300 nm, EIE 14 and PVT1 displayed similar clustering behaviour with MYC (Fig. 3h and Extended Data Fig. 3d,e). This clustering suggests that EIE 14 is acting as a proximity-dependent regulator of MYC reminiscent of enhancer–promoter interactions42. Altogether, the spatial clustering behaviour of this ecDNA species measured here and previously20, the propensity for MYC to engage in ‘enhancer hijacking’43 and the ability of reactivated repetitive elements to engage in long-range gene activation27 suggest that any genomically linear separation of MYC and EIE 14 is overcome in both cis (interaction with MYC on the same ecDNA molecule) and trans (ecDNA–ecDNA interactions).
EIE 14 is critical for cancer cell fitness and displays enhancer activity
To test whether the identified TEs are important for the cancer cell proliferation, we performed a CRISPR interference (CRISPRi) growth screen targeting a subset of EIEs in COLO320DM cells engineered to stably express dCas9-KRAB44 (Fig. 4a,b). We were able to target 36 out of the 68 EIEs with single guide RNAs (sgRNAs) that met the following criteria: (1) must meet stringent specificity criteria to reduce potential off targets intrinsic to repetitive sequences (Methods) and (2) have at least two sgRNAs per EIE. We also included 125 non-targeting controls (NTC) that were introduced into cells with the EIE sgRNAs via lentiviral transduction (Supplementary Table 10). After transduction, we monitored cell proliferation at multiple timepoints: 4 days (baseline), 3 days after baseline, 14 days and 1 month (30 days), followed by deep sequencing to quantify sgRNA frequencies (Fig. 4b). We obtained highly reproducible guide counts across replicates and timepoints (Extended Data Fig. 4b,c).
Our data showed that the growth phenotype curve for 3 out of 36 of our targeted EIEs at various timepoints indicated a Z score of less than −1, which suggested a significant negative impact on cell viability, with an acute growth defect after only 3 days (Fig. 4b, Extended Data Fig. 4 and Supplementary Tables 8 and 9). These elements were categorized as evolutionarily older based on their retrotransposition activity in the human genome and spanned classes (LINEs, SINEs and LTRs) (Supplementary Table 11). The enrichment of old TEs may be confounded by the relative ease of targeting sequences with increased sequence divergence. They are generally found in gene-poor regions, making it unlikely that silencing would lead to secondary effects from heterochromatin spreading. Collectively, these results suggest that a subset of our targeted EIEs, including EIE 14, can contribute to cancer cell growth and fitness. We speculate that this is related to EIE interaction with MYC, as knockdown of this oncogene has been shown to have similar effects on COLO320DM growth and survival45,46. In addition, 3 out of 36 of the measured EIEs also had a Z score greater than 1, indicating a significant increase of cell growth or fitness. The identity of these elements also spanned multiple element classes, with two (EIE 68 and EIE 45) located within uncharacterized non-coding RNAs, and one (EIE 57) within the first exon of the ANKRD30B protein-coding gene, which has been implicated in cell proliferation47. Further investigation of these hits is warranted in future studies to explain their positive effects on cell growth, especially those within the uncharacterized non-coding RNA regions.
The strongest growth defect was observed for perturbation of EIE 14 (Fig. 4b), which when combined with our finding of its co-localization with ecDNA-amplified MYC (Fig. 3h), suggests a potential enhancer-like regulatory role for this EIE. To examine the epigenetic landscape of this element we leveraged copy-number-normalized chromatin immunoprecipitation sequencing (ChIP-seq) measuring H3 lysine 27 acetylation (H3K27ac), BRD4 occupancy and assay for transposase-accessible chromatin using sequencing (ATAC-seq) accessibility data. These epigenetic features are all commonly associated with enhancer activity18,48,49. Notably, many EIEs, including EIE 14, were accessible in COLO320DM cells (Fig. 4c,d and Extended Data Fig. 5). The measured accessibility of EIE 14 contrasts the normally silenced H3 lysine 9 trimethylation (H3k9me3) state across annotated human cell lines50,51 (Fig. 4e). Cross-referencing our identified EIEs with accessibility data from other ecDNA-containing cell lines demonstrated that accessibility of EIEs is a more generalizable phenomenon beyond COLO320DM cells (Extended Data Fig. 5). Altogether, the accessibility and proximal clustering of EIE 14 points towards active regulatory potential of this element in COLO320DM cells, while identification of accessible EIEs across cell lines suggests a broader functional relevance of EIE regulatory potential on ecDNA48,49 (Extended Data Fig. 5).
To determine whether EIE 14 activity is a consequence of ecDNA formation, we performed RNA-FISH on the sequence-specific 1-kb segment of EIE 14 in COLO320DM and isogenic COLO320HSR cells. The homogeneously staining region (HSR) cell line contains a similar copy number amplification of the MYC-amplified portion of chromosome 8, but the majority of these copies have integrated into chromosomes18 (Fig. 5a). We reasoned that, if the unique extrachromosomal context of ecDNA facilitates activation of EIE 14, we should not see evidence of its activity in the COLO320HSR genome-integrated context. Indeed, we observed distinct transcription events in the COLO320DM line (median n = 8 transcripts per cell) but not in the HSR line(median n = 0 transcripts per cell; Fig. 5b and Extended Data Fig. 6a,b).
Finally, to directly test the ability for the EIE 14 sequence to act as an enhancer of MYC expression, we performed a luciferase reporter assay measuring its ability to activate transcription of TK and MYC promoters20,52 (Fig. 5c). EIE 14 significantly increased MYC promoter-mediated reporter gene expression relative to the promoter-only control, signifying bona fide enhancer activity (Fig. 5c). Separating EIE 14 into L1M4a1 and L1PA2 fragments further demonstrated that both sequences can individually act as enhancers, with an additive effect when combined (Extended Data Fig. 6c). In sum, the enhancer-associated features and regulatory activity of the luciferase assay suggested that EIE 14, and possibly other EIEs, have been co-opted as regulatory sequences when found on ecDNA, influencing the expression of ecDNA-borne oncogenes (Fig. 5d).
Discussion
Discussion
This study uncovers a mechanism by which TEs, typically silenced by heterochromatin, may acquire regulatory potential when amplified on ecDNA53–55. Somatically active retrotransposition events56, as induced by LINEs and SINEs, are abundant in the human genome and represent a major source of genetic variation57. Across cancer types, retrotransposon insertions contribute significantly to structural variation, genomic rearrangements, copy number alterations and mutations—including in colorectal cancer58–65. The activity of these elements in cancer can induce genomic instability and drive the acquisition of malignant traits. For instance, when reactivated LINE-1 elements are inserted into the APC tumour suppressor gene in colorectal cancer, they disrupt gene function and confer a selective advantage66. In other contexts, TEs act as bona fide transcriptional enhancers, amplifying oncogenic gene expression and promoting tumorigenesis26.
Here, we describe the enhancer-like activity of a specific identified element, EIE 14, which becomes active through its association with ecDNA (Fig. 5d). ecDNAs, which are randomly segregated during cell division, are subject to strong selective pressure10. The recurrent co-amplification of TEs on ecDNA-containing cell lines suggests they may contribute to ecDNA fitness and oncogenic function. We show that retrotransposons such as L1M4a1/EIE 14 can escape the inactive chromatin environment of their native genomic loci when inserted within the transcriptionally permissive landscape of ecDNA18. In fact, we demonstrate that EIE 14 is transcriptionally active only in the context of ecDNA and not in the endogenous chromosomal context of the copy-number-matched, isogenic COLO320HSR cells. The context-specific transcription suggests a purely epigenetic regulation imbued by the local environment of ecDNA. This environment enables EIE 14 to potentially influence nearby oncogenes such as MYC. Given that LINEs have been shown to exhibit enhancer-like behaviour when reactivated27,28,67, the clustering of ecDNA molecules observed through ORCA may further enhance spatial feedback68 of both cis- and trans-regulatory interactions of EIE 14 with oncogenic targets.
Although EIE 14 is incapable of autonomous transposition and lacks a complete L1M4a1 sequence, its activity following integration into ecDNA suggests that degenerate ancient sequences can become functionally active under appropriate conditions. Previous work has shown that single-nucleotide polymorphisms associated with familial cancer risk often affect the biochemical activity of noncoding enhancer elements linked to oncogenes activated in cancer69,70. Our results extend this model by proposing that inherited variation in ancient TE insertions, such as EIE 14 near MYC, can create latent enhancers that become activated when the oncogene locus is excised into ecDNA.
Perturbation of EIE 14 through CRISPRi resulted in impaired cell growth in COLO320DM cells, indicating that its reactivation contributes to the colorectal cancer phenotype. Quantifying the precise downregulation of MYC is constrained by ecDNA heterogeneity, a narrow temporal window in MYC-addicted cells, rapid growth arrest and subsequent loss of successfully targeted cells. While this functional evidence supports a potential oncogenic role, further studies focusing on in vivo analyses are necessary to determine whether TEs on ecDNA are sufficient to confer a survival advantage or correlate with poor patient prognosis. Notably, recurrent LINE-1 amplification on ecDNA has been observed in primary oesophageal cancer, providing in vivo support for the clinical relevance of this phenomenon71.
Finally, the amplification of retrotransposable elements onto ecDNA introduces a mechanism that increases ecDNA structural variation by leveraging the approximately 40% of the genome composed of typically silenced repetitive elements. Retrotranspositions are, in fact, the second-most frequent type of structural variant in colorectal adenocarcinomas72. Just as transposons have played a major role in bacterial plasmid evolution through cycles of insertion and recombination73, our findings suggest a parallel evolutionary trajectory in human oncogenic ecDNAs. The transcriptionally permissive state of ecDNA enables these elements to potentiate oncogene activation and selection—making them both prognostic biomarkers and potential therapeutic targets.
This study uncovers a mechanism by which TEs, typically silenced by heterochromatin, may acquire regulatory potential when amplified on ecDNA53–55. Somatically active retrotransposition events56, as induced by LINEs and SINEs, are abundant in the human genome and represent a major source of genetic variation57. Across cancer types, retrotransposon insertions contribute significantly to structural variation, genomic rearrangements, copy number alterations and mutations—including in colorectal cancer58–65. The activity of these elements in cancer can induce genomic instability and drive the acquisition of malignant traits. For instance, when reactivated LINE-1 elements are inserted into the APC tumour suppressor gene in colorectal cancer, they disrupt gene function and confer a selective advantage66. In other contexts, TEs act as bona fide transcriptional enhancers, amplifying oncogenic gene expression and promoting tumorigenesis26.
Here, we describe the enhancer-like activity of a specific identified element, EIE 14, which becomes active through its association with ecDNA (Fig. 5d). ecDNAs, which are randomly segregated during cell division, are subject to strong selective pressure10. The recurrent co-amplification of TEs on ecDNA-containing cell lines suggests they may contribute to ecDNA fitness and oncogenic function. We show that retrotransposons such as L1M4a1/EIE 14 can escape the inactive chromatin environment of their native genomic loci when inserted within the transcriptionally permissive landscape of ecDNA18. In fact, we demonstrate that EIE 14 is transcriptionally active only in the context of ecDNA and not in the endogenous chromosomal context of the copy-number-matched, isogenic COLO320HSR cells. The context-specific transcription suggests a purely epigenetic regulation imbued by the local environment of ecDNA. This environment enables EIE 14 to potentially influence nearby oncogenes such as MYC. Given that LINEs have been shown to exhibit enhancer-like behaviour when reactivated27,28,67, the clustering of ecDNA molecules observed through ORCA may further enhance spatial feedback68 of both cis- and trans-regulatory interactions of EIE 14 with oncogenic targets.
Although EIE 14 is incapable of autonomous transposition and lacks a complete L1M4a1 sequence, its activity following integration into ecDNA suggests that degenerate ancient sequences can become functionally active under appropriate conditions. Previous work has shown that single-nucleotide polymorphisms associated with familial cancer risk often affect the biochemical activity of noncoding enhancer elements linked to oncogenes activated in cancer69,70. Our results extend this model by proposing that inherited variation in ancient TE insertions, such as EIE 14 near MYC, can create latent enhancers that become activated when the oncogene locus is excised into ecDNA.
Perturbation of EIE 14 through CRISPRi resulted in impaired cell growth in COLO320DM cells, indicating that its reactivation contributes to the colorectal cancer phenotype. Quantifying the precise downregulation of MYC is constrained by ecDNA heterogeneity, a narrow temporal window in MYC-addicted cells, rapid growth arrest and subsequent loss of successfully targeted cells. While this functional evidence supports a potential oncogenic role, further studies focusing on in vivo analyses are necessary to determine whether TEs on ecDNA are sufficient to confer a survival advantage or correlate with poor patient prognosis. Notably, recurrent LINE-1 amplification on ecDNA has been observed in primary oesophageal cancer, providing in vivo support for the clinical relevance of this phenomenon71.
Finally, the amplification of retrotransposable elements onto ecDNA introduces a mechanism that increases ecDNA structural variation by leveraging the approximately 40% of the genome composed of typically silenced repetitive elements. Retrotranspositions are, in fact, the second-most frequent type of structural variant in colorectal adenocarcinomas72. Just as transposons have played a major role in bacterial plasmid evolution through cycles of insertion and recombination73, our findings suggest a parallel evolutionary trajectory in human oncogenic ecDNAs. The transcriptionally permissive state of ecDNA enables these elements to potentiate oncogene activation and selection—making them both prognostic biomarkers and potential therapeutic targets.
Methods
Methods
Cell culture
Cell lines were obtained from ATCC. COLO320DM (CCL-220) and COLO320-HSR (CCL-220.1) cells were maintained in RPMI; Life Technologies, cat. no. 11875-119 supplemented with 10% foetal bovine serum (Hyclone, cat. no. SH30396.03) and 1% penicillin–streptomycin (Thermo Fisher, cat. no. 15140-122). All cell lines were routinely tested for mycoplasma contamination. The presence of ecDNA in cell lines was confirmed via metaphase spreads.
Hi-C
Ten million cells were fixed in 1% formaldehyde in aliquots of one million cells each for 10 min at room temperature and combined after fixation. We performed the Hi-C assay following a standard protocol to investigate chromatin interactions within colorectal cancer cells74. HiC libraries were sequenced on an Illumina HiSeq 4000 with paired-end 75-bp read lengths. Paired-end HiC reads were aligned to hg19 genome with the HiC-Pro pipeline75. The pipeline was run with default settings, configured to assign reads to DpnII restriction fragments and to filter for valid pairs. The data were then binned to generate raw contact maps that then underwent iterative correction and eigenvector decomposition normalization to remove biases. The HiCCUPS function in Juicer76 was then used to call high-confidence loops. Visualization was done using Juicebox (https://aidenlab.org/juicebox/).
Analysis of EIEs for repetitive element overlap
To assess the overlap of classes of repetitive elements with our identified EIEs, we obtained the ‘RepeatMasker’ and ‘Interrupted Repeats’ tracks from UCSC Genome Browser for hg19. For each EIE, we computed the fraction of the sequence that overlapped with the merged BED file containing the RepeatMasker and Interreputed Repeats annotations. We report the overlap separately for LINE, SINE and LTR repetitive element classes. Importantly, each EIE is exactly 1 kb long, so no length normalization is performed. To compute an expected proportion, we computed the fraction of hg19 covered by each repetitive element class. The results are reported in Fig. 1d and Extended Data Fig. 1a.
Whole-genome sequencing with Oxford Nanopore
High-molecular-weight (HMW) genomic DNA was extracted from approximately 6 million COLO320DM cells using the Monarch HMW DNA Extraction Kit for Tissue (NEB #T3060L) following the Oxford Nanopore Ultra-Long DNA Sequencing Kit V14 protocol. After extracting HMW genomic DNA, we constructed Nanopore libraries using the Oxford Nanopore Ultra-Long DNA Sequencing Kit V14 (SQK-ULK114) kit according to the manufacturer’s instructions. We sequenced libraries on an Oxford Nanopore PromethION using a 10.4.1. Flow Cell (FLO-PRO114M) according to the manufacturer’s instructions. Basecalls from raw POD5 files were computed using Dorado (v.0.2.4).
Identifying and remapping EIE-containing reads and detecting structural variants
We first identified Nanopore reads containing a single element by aligning reads with minimap277 and filtered out reads that were not mapped by the algorithm (denoted by an asterisk in the RNAME column of the BAM entry). Then, taking these reads, we performed genomic alignment once again using minimap2 against hg19.
From these new alignments of only the reads found to contain the element under consideration, we performed two analyses for each element. First, we detected structural variant detection using Sniffles278. Second, we identified overlap of reads with ecDNA-containing intervals that were reconstructed with long reads (see ‘Reconstruction of ecDNA amplicons with long-read data” section). In this second analysis (presented in Fig. 1f), we counted the number of reads covering regions contained with cycles reconstructed with CoRAL algorithm31. While this analysis does not explicitly distinguish reads originating from chromosomal versus extrachromosomal regions, we reasoned that elements carried on ecDNA would be amplified and therefore exhibit higher coverage; conversely, regions primarily chromosomal would show read counts similar to the overall genome coverage.
Reconstruction of ecDNA amplicons with long-read data
We reconstructed ecDNA amplicons from ultralong Oxford Nanopore reads using the CoRAL algorithm31. In brief, this algorithm determines focally amplified regions of the genome using CNVkit79 and then finds reads that support this focally amplified region. In doing so, CoRAL identifies genomic breakpoints between the focally amplified seed region and disparate parts of the genome to create a ‘breakpoint graph’. From this breakpoint graph, putative ecDNA cycles are identified. We report the breakpoint graph in Fig. 1g, which includes a breakpoint between EIE 14 (annotated on chr3) and an intergenic region between CASC8 and MYC on chr8.
In addition to detecting EIE 14 on the MYC-amplifying ecDNA in COLO320DM, we additionally quantified the number of reads that span a given EIE and any part of the COLO320DM genome amplified as ecDNA. We report the number reads that support an EIE as amplified on ecDNA in Fig. 1f.
In Extended Data Fig. 2b, we visualized reads connecting EIE 14 on chr3 with the chr8 ecDNA-amplified region using Ribbon (v 2.0.0)80.
ATAC-seq analysis and normalization
ATAC-seq and ChIP-seq data for COLO320DM and SNU16 was obtained from ref. 20 and for PC3 and GBM39KT from ref. 18. Previously, ATAC-seq data were mapped to hg19. While ChIP-seq data were normalized to input, as input is not sequenced with ATAC-seq, these data were further normalized by library size. Specifically, ATAC-seq data were converted to a bedGraph format reporting the number of reads supporting each base position; these read densities were then normalized to parts per 10 million by dividing each position’s count by a normalization factor based on the total library size. These library-size-normalized data were used for downstream plotting
TE old-versus-young classification
To classify TEs as old or young, we conducted a classification of EIE sequences listed in Supplementary Table 2. Elements were categorized based on their known evolutionary activity in humans. Young elements were defined as those from recently active subfamilies, including L1HS, L1PA2, SVA and AluY, which are known to have current or recent retrotransposition activity in the human genome. Classifications can be found in Supplementary Table 11.
CRISPRi
The pHR-SFFV-dCas9-BFP-KRAB (Addgene, cat. no. 46911) plasmid was modified to dCas9-BFP-KRAB-2A-Blast as previously described81. Lentiviral particles were produced by co-transfecting HEK293T cells with the plasmid along with packaging plasmids psPAX2 and pMD2.G using a standard transfection method. Viral supernatants were collected at 48 and 72 h post-transfection, filtered through a 0.45-μm filter and concentrated by ultracentrifugation at 25,000 rpm for 2 h at 4 °C. Cells were transduced with lentivirus, incubated for 2 days selected with 1 μg ml−1 blasticidin for 10–14 days, and BFP expression was analysed by flow cytometry.
We took sgRNA specificity into account from the design phase of the CRISPRi screen. Our guide selection criteria included off-target scoring from ref. 85 and filtering. We designed the library in benchling (https://benchling.com) with multiple independent sgRNAs per EIE element. This redundancy helps to distinguish on-target biological effects from off-target noise. To increase our stringency and ensure that the effects of low-efficiency or low-specificity guides do not interfere with the interpretation of the screen, we used FlashFry82 to score our gRNAs with multiple tools (Supplementary Table 12) and specifically selected the CRISPRi specificity score developed by ref. 83 for filtering. We report effects only for elements with at least two guides achieving a specificity score greater than 0.2, which is the standard cut-off for this scoring parameter (similar to the Doench et al.84 cumulative distribution function score). The oligo pool encoding guides (Supplementary Table 10) were synthesized by Twist Bio and inserted into addgene Plasmid #52963 lentiGuide-Puro digested with Esp3I enzyme (NEB). The oligo pool was sequence validated. To investigate the effects of CRISPRi, we utilized a lentiviral delivery system to introduce sgRNAs into cells stably expressing the dCas9-KRAB repressor. Lentiviral particles were produced as described above. The viral titre was determined by transducing HEK293T cells with serial dilutions of virus and assessing transduction efficiency via flow cytometry for GFP expression.
For transduction, cells were seeded at a density of 1 × 106 cells per well in six-well plates and transduced overnight with lentivirus at a low multiplicity of infection of 0.3, ensuring single sgRNA integration per cell. The following day, the medium was replaced with fresh growth medium. Two days post-transduction, cells were selected with 0.5 μg ml−1 puromycin for 4 days to enrich successfully transduced cells. GFP expression was monitored by flow cytometry to assess transduction efficiency. After selection, cells were collected at multiple timepoints: baseline (day 4 after transduction), day 3, week 1 and month 1 (30 days). Genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s instructions.
Integrated sgRNA sequences were amplified from genomic DNA using a multistep PCR process. First, sgRNA cassettes were amplified using Primer set 1: hU6_pcr_out_fw (tggactatcatatgcttaccgtaacttgaaagt) and efs_pcr_rev (ctaggcaccggatcaattgccga). PCR reactions contained 0.8 μl each of 25 μM primers, 1–2 μg genomic DNA, water and 25 μL NEB 2x master mix in a total volume of 50 μl. PCR conditions included an initial 3 min at 98 °C, followed by 15–17 cycles of 20 s at 98 °C, 20 s at 58 °C and 30 s at 72 °C, concluding with a final extension for 1 min at 72 °C. PCR products (~400 bp) were verified by gel electrophoresis and purified. The second PCR step added Illumina sequencing adapters using primers (P5 stagger -hu6 and p7adpt_spRNAl105nt_rev). Reactions contained 10–50 ng of purified PCR1 product, 0.8 μl of each primer, water and 25 μl of NEB 2× master mix in a total volume of 50 μl. PCR conditions were: initial denaturation for 30 s at 98 °C, followed by six cycles of 15 s at 98 °C, 15 s at 60 °C and 30 s at 72 °C, with a final extension of 1 min at 72 °C. PCR products (200–300 bp) were gel-verified and purified using AMPure XP beads. A final indexing PCR step was performed using Truseq-based P5 and P7 indexing primers. Reactions contained 10–50 ng DNA from PCR2, 0.8 μl of each primer, water and 25 μl NEB 2× master mix in 50 μl total volume. Conditions included 30 s at 98 °C followed by six cycles of 15 s at 98 °C, 15 s at 63 °C and 30 s at 72 °C, ending with a 1-min extension at 72 °C. Products were purified with AMPure XP beads and sequenced on an Illumina NextSeq platform using single-end 50-bp reads. Sequencing data were processed to quantify sgRNA representation at each timepoint, allowing analysis of sgRNA abundance dynamics over the experiment duration.
CRISPRi fitness screen analysis
To compute the effect of each guide on cell fitness, we first quantified guide counts from sequencing libraries. To normalize counts across libraries, we converted raw guide counts to counts per million (CPM) and retained guides that had CPM values of at least 20 across all days tested. We also filtered out guides with high off-target scores (Supplementary Table 12, 0.2 cut-off from optimized CRISPRi design parameters83) and excluded EIEs with fewer than two guides remaining after filtering. After confirming that normalized guide abundances were robust across replicates, we proceeded with our analysis using the average of guide replicates at each timepoint. We next scored the relative fitness of each guide against the NTC by computing the ratio of CPM values between a guide and the NTC at the particular timepoint. Finally, we transformed this distribution to Z scores and reported this as the relative fitness effect of each guide.
CRISPR-CATCH
In our study, we used the CRISPR-CATCH technique to isolate and analyse ecDNA structures. Following the standard protocol22, we designed two sgRNAs targeting specific enhancer regions: sgRNA #1 (ATATAGGACAGTATCAAGTA) and sgRNA #2 (TATATTATTAGTCTGCTGAA). These sgRNAs directed the Cas9 nuclease to introduce double-strand breaks at the targeted sites, linearizing the circular ecDNA molecules. The linearized DNA was then subjected to PFGE using Saccharomyces cerevisiae and Hansenula
wingei DNA ladders as molecular weight markers to facilitate size-based separation. Distinct DNA bands corresponding to the targeted ecDNA were excised from the gel for downstream analyses, including sequencing.
Probe design
Probes were designed against human genome assembly hg19, tiling the regions in Supplementary Table 7 using the probe designing software described previously36,37. We restricted the selection of the 40-mer probe targeting regions to a GC content between 20% and 80% and a melting temperature of 65–90 °C, and excluded sequences with non-unique homology—defined as sharing a 17-mer or longer sequence with other genomic regions—or homology to common repetitive elements in the human genome listed in RepBase, using a 14-mer cut-off. Targeting probes were then appended with a 20-mer barcode per target region. Probe design software is available via GitHub at https://github.com/BoettigerLab/ORCA-public. Finalized probe libraries were ordered as an oligo-pool from GenScript.
ORCA imaging
ORCA hybridization was performed as previously described36,37. In brief, 40-mm Bioptechs coverslips were prepared with EMD Millipore poly-D-lysine solution (1 mg ml−1, 20 ml, dilute 1:10) (Sigma, cat. no. A003E) for 40 min. Coverslips were then rinsed three times in 1× PBS. Cells were passaged onto the coverslips and allowed to adhere overnight. The next day, the coverslip with cells were rinsed three times in 1× PBS and then fixed for 10 min in 4% paraformaldehyde. For DNA imaging, cells were then permeabilized in 0.5% Triton-X 1× PBS for 10 min followed by 5 min of denaturing in 0.1 M HCl. A 35-min incubation in hybridization buffer prepared samples for the primary probe. Primary probes were added (1 μg) directly to the sample in hybridization solution, and then the sample was heated to 90 °C for 3 min. An overnight 42 °C incubation (or at least 8 h incubation) was performed, followed by post-fixation in 8% paraformaldehyde + 2% glutaraldehyde in 1× PBS, before being stored in 2× SSC or used immediately for imaging. For RNA imaging, the HCl, heat and post-fixation steps were omitted.
DNA samples were imaged on one of two different homebuilt set-ups designed for ORCA, ‘scope-1’ or ‘scope-3’, depending on instrument availability. Microscope design parameters were deposited in the Micro-Meta App85. The design and assembly of the scope-1 system is described in detail in our prior protocol paper37. Both systems use a similar auto-focus system, fluidics system and scientific complementary metal-oxide-semiconductor camera (Hamamatsu FLASH 4.0), although scope-3 had a larger field of view (2,048 × 2,048 108-nm pixels) compared with scope-1 (1,024 × 1,024 154-nm pixels).
RNA samples were imaged on a different homebuilt set-up designed for ORCA designated as the ‘Yale lumencor system’. This system uses a similar auto-focus system and fluidics system, with a scientific complementary metal-oxide-semiconductor camera (Hamamatsu ORCA BT fusion) with a field of view of 2,304 × 2,304 at 108 nm per pixels and an Olympus PlanApo 60× objective.
Automated fluidics handling is described in detail in our prior protocol paper37. In brief, fluid exchange between each imaging step was performed by a homebuilt robotic set-up. The system used a three-axis computer numerical control router engraver, buffer reservoirs and hybridization wells (96-well plate) on a three-axis stage, ethylene tetrafluoroethylene tubing, imaging chamber (FCS2, Bioptechs), a needle and peristaltic pump (Gilson F155006). The needle was moved between buffers or hybridization wells and transported across the samples through tubing using a peristaltic pump. Open-source software for the control of the fluidics system is described in the ‘Software availability’ section.
Sequential imaging of ORCA probes was conducted alternating between hybridization of fluorescent adapter probes, readout probes complementary to the barcodes on the primary probe sequences, imaging and stripping of probes, as described previously36,37. In brief, a z-stack spanning 10 μm was acquired with 250 nm step sizes, alternating laser excitation between the data channel and fiducial marker at each step. Readout probes were labelled with Alexa-750 fluorophores. The fiducial probe was labelled in cy3 and added only in the initial round. RNA imaging was performed with the EIE 14 probe labelled with the Alexa-750 and the MYC probe labelled with the Cy5 fluorophores.
Sequence for the fiducial: /5Cy3/AGCTGATCGTGGCGTTGATGCCGGGTCGAT
Sequence of Cy5: /5Cy5/TGGGACGGTTCCAATCGGATC
Sequence of the 750:/5Alex750N/ACCTCCGTTAGACCCGTCAG
Image processing
Image processing was performed with custom MATLAB functions available via GitHub at https://github.com/BoettigerLab/ORCA-public. In brief, cells were maximum projected, and pixel-scale alignment across all fields of view was computed using the fiducial signal. This alignment was then applied in three dimensions across all 250-nm z steps. Cellpose86 was then used to segment individual cells. A cell-by-cell fine scale (subpixel) alignment was then computed, and aligned individual cells were then ready for 3D-spot calling. The individual ecDNA spots and their 3D positions computed to subpixel accuracy using the corresponding raw 3D image stacks and the 3D DaoSTORM function in storm-analysis toolbox (10.5281/zenodo.3528330), an open-source software for single-molecule localization, adapted for dense and overlapping emitters following the DaoSTORM algorithm87. DaoSTORM was run in the 2D-fixed mode, as the 3D fitting modes are for estimating axial position from astigmatism in the xy plane, rather than computing it directly from a z-stack. The fixed-width point spread function of the microscope is precomputed using 100-nm (subdiffraction) fluorescent beads. A minimum detection threshold of 30 sigma was used for the fit. The z-position of the localizations was computed using Gaussian fit to the vertically stacked localizations, with an axial Gaussian width also precomputed from z-stack images with 100-nm fluorescent beads. Additional information can be found in the read-the-docs for storm-analysis at https://storm-analysis.readthedocs.io/en/latest/.
Minimum pairwise distance quantification
All pairwise distances between genomic regions were calculated on a per-cell basis. The shortest distances were saved for each MYC centroid and EIE 14 and PVT1 such that each MYC centroid has one corresponding shortest distance per EIE 14 and PVT1. For each cell, a sphere radius r = 4um (the average radius of cells calculated with Cellpose mask) with randomly simulated points corresponding to the number of MYC, EIE 14 and PVT1 centroids. The same minimum pairwise distance quantification was calculated on the randomly simulated points.
Ripley’s K quantification
To calculate the density-corrected distance ratios, a distance cut-off of 2 μm and an interval density of 0.01:0.01:2 was used. The spatial relationship between MYC and EIE 14 and MYC and PVT1 were quantified as follows. On a per-cell basis, the distance density function was calculated, truncated at the specified cut-off. A uniform distribution was then computed over the same interval, and a ratio of these values was taken. This ratio was then corrected by the volume of the interval shell.
Reporter plasmid construction and transfection
All plasmids are made with Gibson assembly (NEB HIFI DNA assembly kit) according to the manufacturer’s protocol. We used a plasmid from this publication20 containing the MYC promoter (chr8:128,745,990–128,748,526, hg19) driving NanoLuc luciferase (PVT1p-nLuc) and a constitutive thymidine kinase (TK) promoter driving Firefly luciferase. This plasmid served as the negative control. pGL4-tk-luc2 (Promega) plasmids with an enhancer (chr8:128347148–128348310) were used as the positive control20. In the test plasmid, the cis-enhancer was replaced by 1.7 kb sequence of EIE 14 or by Part #1: L1PA2 or by Part #2: L1M4a1 (Supplementary Table 13). To assess luciferase reporter expression, COLO320DM cells were seeded into a 24-well plate with 100,000 cells per well. Reporter plasmids were transfected into cells the next day with Lipofectamine 3000 following the manufacturer’s protocol, using 0.25 μg DNA per well. Luciferase levels were quantified using Nano-Glo Dual reporter luciferase assay (Promega).
Statistics and reproducibility
All statistical tests used, replicate information and sample size information are reported in the figure legends. No statistical method was used to predetermine sample size. No samples or data points were excluded. The experiments were not randomized. The investigators were not blinded to the conditions of the experiments during data analysis.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Cell culture
Cell lines were obtained from ATCC. COLO320DM (CCL-220) and COLO320-HSR (CCL-220.1) cells were maintained in RPMI; Life Technologies, cat. no. 11875-119 supplemented with 10% foetal bovine serum (Hyclone, cat. no. SH30396.03) and 1% penicillin–streptomycin (Thermo Fisher, cat. no. 15140-122). All cell lines were routinely tested for mycoplasma contamination. The presence of ecDNA in cell lines was confirmed via metaphase spreads.
Hi-C
Ten million cells were fixed in 1% formaldehyde in aliquots of one million cells each for 10 min at room temperature and combined after fixation. We performed the Hi-C assay following a standard protocol to investigate chromatin interactions within colorectal cancer cells74. HiC libraries were sequenced on an Illumina HiSeq 4000 with paired-end 75-bp read lengths. Paired-end HiC reads were aligned to hg19 genome with the HiC-Pro pipeline75. The pipeline was run with default settings, configured to assign reads to DpnII restriction fragments and to filter for valid pairs. The data were then binned to generate raw contact maps that then underwent iterative correction and eigenvector decomposition normalization to remove biases. The HiCCUPS function in Juicer76 was then used to call high-confidence loops. Visualization was done using Juicebox (https://aidenlab.org/juicebox/).
Analysis of EIEs for repetitive element overlap
To assess the overlap of classes of repetitive elements with our identified EIEs, we obtained the ‘RepeatMasker’ and ‘Interrupted Repeats’ tracks from UCSC Genome Browser for hg19. For each EIE, we computed the fraction of the sequence that overlapped with the merged BED file containing the RepeatMasker and Interreputed Repeats annotations. We report the overlap separately for LINE, SINE and LTR repetitive element classes. Importantly, each EIE is exactly 1 kb long, so no length normalization is performed. To compute an expected proportion, we computed the fraction of hg19 covered by each repetitive element class. The results are reported in Fig. 1d and Extended Data Fig. 1a.
Whole-genome sequencing with Oxford Nanopore
High-molecular-weight (HMW) genomic DNA was extracted from approximately 6 million COLO320DM cells using the Monarch HMW DNA Extraction Kit for Tissue (NEB #T3060L) following the Oxford Nanopore Ultra-Long DNA Sequencing Kit V14 protocol. After extracting HMW genomic DNA, we constructed Nanopore libraries using the Oxford Nanopore Ultra-Long DNA Sequencing Kit V14 (SQK-ULK114) kit according to the manufacturer’s instructions. We sequenced libraries on an Oxford Nanopore PromethION using a 10.4.1. Flow Cell (FLO-PRO114M) according to the manufacturer’s instructions. Basecalls from raw POD5 files were computed using Dorado (v.0.2.4).
Identifying and remapping EIE-containing reads and detecting structural variants
We first identified Nanopore reads containing a single element by aligning reads with minimap277 and filtered out reads that were not mapped by the algorithm (denoted by an asterisk in the RNAME column of the BAM entry). Then, taking these reads, we performed genomic alignment once again using minimap2 against hg19.
From these new alignments of only the reads found to contain the element under consideration, we performed two analyses for each element. First, we detected structural variant detection using Sniffles278. Second, we identified overlap of reads with ecDNA-containing intervals that were reconstructed with long reads (see ‘Reconstruction of ecDNA amplicons with long-read data” section). In this second analysis (presented in Fig. 1f), we counted the number of reads covering regions contained with cycles reconstructed with CoRAL algorithm31. While this analysis does not explicitly distinguish reads originating from chromosomal versus extrachromosomal regions, we reasoned that elements carried on ecDNA would be amplified and therefore exhibit higher coverage; conversely, regions primarily chromosomal would show read counts similar to the overall genome coverage.
Reconstruction of ecDNA amplicons with long-read data
We reconstructed ecDNA amplicons from ultralong Oxford Nanopore reads using the CoRAL algorithm31. In brief, this algorithm determines focally amplified regions of the genome using CNVkit79 and then finds reads that support this focally amplified region. In doing so, CoRAL identifies genomic breakpoints between the focally amplified seed region and disparate parts of the genome to create a ‘breakpoint graph’. From this breakpoint graph, putative ecDNA cycles are identified. We report the breakpoint graph in Fig. 1g, which includes a breakpoint between EIE 14 (annotated on chr3) and an intergenic region between CASC8 and MYC on chr8.
In addition to detecting EIE 14 on the MYC-amplifying ecDNA in COLO320DM, we additionally quantified the number of reads that span a given EIE and any part of the COLO320DM genome amplified as ecDNA. We report the number reads that support an EIE as amplified on ecDNA in Fig. 1f.
In Extended Data Fig. 2b, we visualized reads connecting EIE 14 on chr3 with the chr8 ecDNA-amplified region using Ribbon (v 2.0.0)80.
ATAC-seq analysis and normalization
ATAC-seq and ChIP-seq data for COLO320DM and SNU16 was obtained from ref. 20 and for PC3 and GBM39KT from ref. 18. Previously, ATAC-seq data were mapped to hg19. While ChIP-seq data were normalized to input, as input is not sequenced with ATAC-seq, these data were further normalized by library size. Specifically, ATAC-seq data were converted to a bedGraph format reporting the number of reads supporting each base position; these read densities were then normalized to parts per 10 million by dividing each position’s count by a normalization factor based on the total library size. These library-size-normalized data were used for downstream plotting
TE old-versus-young classification
To classify TEs as old or young, we conducted a classification of EIE sequences listed in Supplementary Table 2. Elements were categorized based on their known evolutionary activity in humans. Young elements were defined as those from recently active subfamilies, including L1HS, L1PA2, SVA and AluY, which are known to have current or recent retrotransposition activity in the human genome. Classifications can be found in Supplementary Table 11.
CRISPRi
The pHR-SFFV-dCas9-BFP-KRAB (Addgene, cat. no. 46911) plasmid was modified to dCas9-BFP-KRAB-2A-Blast as previously described81. Lentiviral particles were produced by co-transfecting HEK293T cells with the plasmid along with packaging plasmids psPAX2 and pMD2.G using a standard transfection method. Viral supernatants were collected at 48 and 72 h post-transfection, filtered through a 0.45-μm filter and concentrated by ultracentrifugation at 25,000 rpm for 2 h at 4 °C. Cells were transduced with lentivirus, incubated for 2 days selected with 1 μg ml−1 blasticidin for 10–14 days, and BFP expression was analysed by flow cytometry.
We took sgRNA specificity into account from the design phase of the CRISPRi screen. Our guide selection criteria included off-target scoring from ref. 85 and filtering. We designed the library in benchling (https://benchling.com) with multiple independent sgRNAs per EIE element. This redundancy helps to distinguish on-target biological effects from off-target noise. To increase our stringency and ensure that the effects of low-efficiency or low-specificity guides do not interfere with the interpretation of the screen, we used FlashFry82 to score our gRNAs with multiple tools (Supplementary Table 12) and specifically selected the CRISPRi specificity score developed by ref. 83 for filtering. We report effects only for elements with at least two guides achieving a specificity score greater than 0.2, which is the standard cut-off for this scoring parameter (similar to the Doench et al.84 cumulative distribution function score). The oligo pool encoding guides (Supplementary Table 10) were synthesized by Twist Bio and inserted into addgene Plasmid #52963 lentiGuide-Puro digested with Esp3I enzyme (NEB). The oligo pool was sequence validated. To investigate the effects of CRISPRi, we utilized a lentiviral delivery system to introduce sgRNAs into cells stably expressing the dCas9-KRAB repressor. Lentiviral particles were produced as described above. The viral titre was determined by transducing HEK293T cells with serial dilutions of virus and assessing transduction efficiency via flow cytometry for GFP expression.
For transduction, cells were seeded at a density of 1 × 106 cells per well in six-well plates and transduced overnight with lentivirus at a low multiplicity of infection of 0.3, ensuring single sgRNA integration per cell. The following day, the medium was replaced with fresh growth medium. Two days post-transduction, cells were selected with 0.5 μg ml−1 puromycin for 4 days to enrich successfully transduced cells. GFP expression was monitored by flow cytometry to assess transduction efficiency. After selection, cells were collected at multiple timepoints: baseline (day 4 after transduction), day 3, week 1 and month 1 (30 days). Genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s instructions.
Integrated sgRNA sequences were amplified from genomic DNA using a multistep PCR process. First, sgRNA cassettes were amplified using Primer set 1: hU6_pcr_out_fw (tggactatcatatgcttaccgtaacttgaaagt) and efs_pcr_rev (ctaggcaccggatcaattgccga). PCR reactions contained 0.8 μl each of 25 μM primers, 1–2 μg genomic DNA, water and 25 μL NEB 2x master mix in a total volume of 50 μl. PCR conditions included an initial 3 min at 98 °C, followed by 15–17 cycles of 20 s at 98 °C, 20 s at 58 °C and 30 s at 72 °C, concluding with a final extension for 1 min at 72 °C. PCR products (~400 bp) were verified by gel electrophoresis and purified. The second PCR step added Illumina sequencing adapters using primers (P5 stagger -hu6 and p7adpt_spRNAl105nt_rev). Reactions contained 10–50 ng of purified PCR1 product, 0.8 μl of each primer, water and 25 μl of NEB 2× master mix in a total volume of 50 μl. PCR conditions were: initial denaturation for 30 s at 98 °C, followed by six cycles of 15 s at 98 °C, 15 s at 60 °C and 30 s at 72 °C, with a final extension of 1 min at 72 °C. PCR products (200–300 bp) were gel-verified and purified using AMPure XP beads. A final indexing PCR step was performed using Truseq-based P5 and P7 indexing primers. Reactions contained 10–50 ng DNA from PCR2, 0.8 μl of each primer, water and 25 μl NEB 2× master mix in 50 μl total volume. Conditions included 30 s at 98 °C followed by six cycles of 15 s at 98 °C, 15 s at 63 °C and 30 s at 72 °C, ending with a 1-min extension at 72 °C. Products were purified with AMPure XP beads and sequenced on an Illumina NextSeq platform using single-end 50-bp reads. Sequencing data were processed to quantify sgRNA representation at each timepoint, allowing analysis of sgRNA abundance dynamics over the experiment duration.
CRISPRi fitness screen analysis
To compute the effect of each guide on cell fitness, we first quantified guide counts from sequencing libraries. To normalize counts across libraries, we converted raw guide counts to counts per million (CPM) and retained guides that had CPM values of at least 20 across all days tested. We also filtered out guides with high off-target scores (Supplementary Table 12, 0.2 cut-off from optimized CRISPRi design parameters83) and excluded EIEs with fewer than two guides remaining after filtering. After confirming that normalized guide abundances were robust across replicates, we proceeded with our analysis using the average of guide replicates at each timepoint. We next scored the relative fitness of each guide against the NTC by computing the ratio of CPM values between a guide and the NTC at the particular timepoint. Finally, we transformed this distribution to Z scores and reported this as the relative fitness effect of each guide.
CRISPR-CATCH
In our study, we used the CRISPR-CATCH technique to isolate and analyse ecDNA structures. Following the standard protocol22, we designed two sgRNAs targeting specific enhancer regions: sgRNA #1 (ATATAGGACAGTATCAAGTA) and sgRNA #2 (TATATTATTAGTCTGCTGAA). These sgRNAs directed the Cas9 nuclease to introduce double-strand breaks at the targeted sites, linearizing the circular ecDNA molecules. The linearized DNA was then subjected to PFGE using Saccharomyces cerevisiae and Hansenula
wingei DNA ladders as molecular weight markers to facilitate size-based separation. Distinct DNA bands corresponding to the targeted ecDNA were excised from the gel for downstream analyses, including sequencing.
Probe design
Probes were designed against human genome assembly hg19, tiling the regions in Supplementary Table 7 using the probe designing software described previously36,37. We restricted the selection of the 40-mer probe targeting regions to a GC content between 20% and 80% and a melting temperature of 65–90 °C, and excluded sequences with non-unique homology—defined as sharing a 17-mer or longer sequence with other genomic regions—or homology to common repetitive elements in the human genome listed in RepBase, using a 14-mer cut-off. Targeting probes were then appended with a 20-mer barcode per target region. Probe design software is available via GitHub at https://github.com/BoettigerLab/ORCA-public. Finalized probe libraries were ordered as an oligo-pool from GenScript.
ORCA imaging
ORCA hybridization was performed as previously described36,37. In brief, 40-mm Bioptechs coverslips were prepared with EMD Millipore poly-D-lysine solution (1 mg ml−1, 20 ml, dilute 1:10) (Sigma, cat. no. A003E) for 40 min. Coverslips were then rinsed three times in 1× PBS. Cells were passaged onto the coverslips and allowed to adhere overnight. The next day, the coverslip with cells were rinsed three times in 1× PBS and then fixed for 10 min in 4% paraformaldehyde. For DNA imaging, cells were then permeabilized in 0.5% Triton-X 1× PBS for 10 min followed by 5 min of denaturing in 0.1 M HCl. A 35-min incubation in hybridization buffer prepared samples for the primary probe. Primary probes were added (1 μg) directly to the sample in hybridization solution, and then the sample was heated to 90 °C for 3 min. An overnight 42 °C incubation (or at least 8 h incubation) was performed, followed by post-fixation in 8% paraformaldehyde + 2% glutaraldehyde in 1× PBS, before being stored in 2× SSC or used immediately for imaging. For RNA imaging, the HCl, heat and post-fixation steps were omitted.
DNA samples were imaged on one of two different homebuilt set-ups designed for ORCA, ‘scope-1’ or ‘scope-3’, depending on instrument availability. Microscope design parameters were deposited in the Micro-Meta App85. The design and assembly of the scope-1 system is described in detail in our prior protocol paper37. Both systems use a similar auto-focus system, fluidics system and scientific complementary metal-oxide-semiconductor camera (Hamamatsu FLASH 4.0), although scope-3 had a larger field of view (2,048 × 2,048 108-nm pixels) compared with scope-1 (1,024 × 1,024 154-nm pixels).
RNA samples were imaged on a different homebuilt set-up designed for ORCA designated as the ‘Yale lumencor system’. This system uses a similar auto-focus system and fluidics system, with a scientific complementary metal-oxide-semiconductor camera (Hamamatsu ORCA BT fusion) with a field of view of 2,304 × 2,304 at 108 nm per pixels and an Olympus PlanApo 60× objective.
Automated fluidics handling is described in detail in our prior protocol paper37. In brief, fluid exchange between each imaging step was performed by a homebuilt robotic set-up. The system used a three-axis computer numerical control router engraver, buffer reservoirs and hybridization wells (96-well plate) on a three-axis stage, ethylene tetrafluoroethylene tubing, imaging chamber (FCS2, Bioptechs), a needle and peristaltic pump (Gilson F155006). The needle was moved between buffers or hybridization wells and transported across the samples through tubing using a peristaltic pump. Open-source software for the control of the fluidics system is described in the ‘Software availability’ section.
Sequential imaging of ORCA probes was conducted alternating between hybridization of fluorescent adapter probes, readout probes complementary to the barcodes on the primary probe sequences, imaging and stripping of probes, as described previously36,37. In brief, a z-stack spanning 10 μm was acquired with 250 nm step sizes, alternating laser excitation between the data channel and fiducial marker at each step. Readout probes were labelled with Alexa-750 fluorophores. The fiducial probe was labelled in cy3 and added only in the initial round. RNA imaging was performed with the EIE 14 probe labelled with the Alexa-750 and the MYC probe labelled with the Cy5 fluorophores.
Sequence for the fiducial: /5Cy3/AGCTGATCGTGGCGTTGATGCCGGGTCGAT
Sequence of Cy5: /5Cy5/TGGGACGGTTCCAATCGGATC
Sequence of the 750:/5Alex750N/ACCTCCGTTAGACCCGTCAG
Image processing
Image processing was performed with custom MATLAB functions available via GitHub at https://github.com/BoettigerLab/ORCA-public. In brief, cells were maximum projected, and pixel-scale alignment across all fields of view was computed using the fiducial signal. This alignment was then applied in three dimensions across all 250-nm z steps. Cellpose86 was then used to segment individual cells. A cell-by-cell fine scale (subpixel) alignment was then computed, and aligned individual cells were then ready for 3D-spot calling. The individual ecDNA spots and their 3D positions computed to subpixel accuracy using the corresponding raw 3D image stacks and the 3D DaoSTORM function in storm-analysis toolbox (10.5281/zenodo.3528330), an open-source software for single-molecule localization, adapted for dense and overlapping emitters following the DaoSTORM algorithm87. DaoSTORM was run in the 2D-fixed mode, as the 3D fitting modes are for estimating axial position from astigmatism in the xy plane, rather than computing it directly from a z-stack. The fixed-width point spread function of the microscope is precomputed using 100-nm (subdiffraction) fluorescent beads. A minimum detection threshold of 30 sigma was used for the fit. The z-position of the localizations was computed using Gaussian fit to the vertically stacked localizations, with an axial Gaussian width also precomputed from z-stack images with 100-nm fluorescent beads. Additional information can be found in the read-the-docs for storm-analysis at https://storm-analysis.readthedocs.io/en/latest/.
Minimum pairwise distance quantification
All pairwise distances between genomic regions were calculated on a per-cell basis. The shortest distances were saved for each MYC centroid and EIE 14 and PVT1 such that each MYC centroid has one corresponding shortest distance per EIE 14 and PVT1. For each cell, a sphere radius r = 4um (the average radius of cells calculated with Cellpose mask) with randomly simulated points corresponding to the number of MYC, EIE 14 and PVT1 centroids. The same minimum pairwise distance quantification was calculated on the randomly simulated points.
Ripley’s K quantification
To calculate the density-corrected distance ratios, a distance cut-off of 2 μm and an interval density of 0.01:0.01:2 was used. The spatial relationship between MYC and EIE 14 and MYC and PVT1 were quantified as follows. On a per-cell basis, the distance density function was calculated, truncated at the specified cut-off. A uniform distribution was then computed over the same interval, and a ratio of these values was taken. This ratio was then corrected by the volume of the interval shell.
Reporter plasmid construction and transfection
All plasmids are made with Gibson assembly (NEB HIFI DNA assembly kit) according to the manufacturer’s protocol. We used a plasmid from this publication20 containing the MYC promoter (chr8:128,745,990–128,748,526, hg19) driving NanoLuc luciferase (PVT1p-nLuc) and a constitutive thymidine kinase (TK) promoter driving Firefly luciferase. This plasmid served as the negative control. pGL4-tk-luc2 (Promega) plasmids with an enhancer (chr8:128347148–128348310) were used as the positive control20. In the test plasmid, the cis-enhancer was replaced by 1.7 kb sequence of EIE 14 or by Part #1: L1PA2 or by Part #2: L1M4a1 (Supplementary Table 13). To assess luciferase reporter expression, COLO320DM cells were seeded into a 24-well plate with 100,000 cells per well. Reporter plasmids were transfected into cells the next day with Lipofectamine 3000 following the manufacturer’s protocol, using 0.25 μg DNA per well. Luciferase levels were quantified using Nano-Glo Dual reporter luciferase assay (Promega).
Statistics and reproducibility
All statistical tests used, replicate information and sample size information are reported in the figure legends. No statistical method was used to predetermine sample size. No samples or data points were excluded. The experiments were not randomized. The investigators were not blinded to the conditions of the experiments during data analysis.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Online content
Online content
Any methods, additional references, Nature Portfolio reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at 10.1038/s41556-025-01788-6.
Any methods, additional references, Nature Portfolio reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at 10.1038/s41556-025-01788-6.
Supplementary information
Supplementary information
Source data
Source data
출처: PubMed Central (JATS). 라이선스는 원 publisher 정책을 따릅니다 — 인용 시 원문을 표기해 주세요.
🏷️ 같은 키워드 · 무료전문 — 이 논문 MeSH/keyword 기반
- A Phase I Study of Hydroxychloroquine and Suba-Itraconazole in Men with Biochemical Relapse of Prostate Cancer (HITMAN-PC): Dose Escalation Results.
- Self-management of male urinary symptoms: qualitative findings from a primary care trial.
- Clinical and Liquid Biomarkers of 20-Year Prostate Cancer Risk in Men Aged 45 to 70 Years.
- Diagnostic accuracy of Ga-PSMA PET/CT versus multiparametric MRI for preoperative pelvic invasion in the patients with prostate cancer.
- Comprehensive analysis of androgen receptor splice variant target gene expression in prostate cancer.
- Clinical Presentation and Outcomes of Patients Undergoing Surgery for Thyroid Cancer.