CDC5L binds to ELAVL1 to inhibit pyroptosis in hepatocellular carcinoma through the Caspase 3/GSDME signaling pathway.
1/5 보강
Hepatocellular carcinoma (HCC) is associated with elevated rates of illness and mortality, posing a significant challenge to global health.
APA
Liang S, Zhu Z, et al. (2025). CDC5L binds to ELAVL1 to inhibit pyroptosis in hepatocellular carcinoma through the Caspase 3/GSDME signaling pathway.. International journal of molecular medicine, 56(6). https://doi.org/10.3892/ijmm.2025.5639
MLA
Liang S, et al.. "CDC5L binds to ELAVL1 to inhibit pyroptosis in hepatocellular carcinoma through the Caspase 3/GSDME signaling pathway.." International journal of molecular medicine, vol. 56, no. 6, 2025.
PMID
40937577 ↗
Abstract 한글 요약
Hepatocellular carcinoma (HCC) is associated with elevated rates of illness and mortality, posing a significant challenge to global health. Elevated levels of cell division cycle 5 like (CDC5L) in HCC predict a poor prognosis. The present study aimed to elucidate the role of CDC5L in HCC. First, CDC5L expression was detected using bioinformatics analysis and validated on clinical samples and cells. Next, CDC5L was knocked down and overexpressed. CDC5L and Caspase 3 knockdown was conducted to explore the effect on pyroptosis in HCC. The mechanisms of HCC pyroptosis were investigated by interfering with and overexpressing ELAV like RNA binding protein 1 (ELAVL1), as well as interfering with CDC5L and overexpressing ELAVL1. Finally, the role of CDC5L/ELAVL1 in regulating Caspase 3/Caspase 3‑-gasdermin E (GSDME) in HCC pyroptosis was validated through cellular and animal experiments. It was found that CDC5L expression was increased in HCC. Elevated CDC5L levels were linked to adverse outcomes in HCC. Suppressing CDC5L expression reduced cell viability, curbed cell proliferation and diminished cell migration and invasion capabilities, while simultaneously enhancing pyroptosis. Additionally, CDC5L knockdown resulted in a progressive decline in tumor volume and a decrease in tumor size and weight. CDC5L overexpression exerted an opposite effect. Moreover, regulating pyroptosis in HCC by CDC5L was dependent on Caspase family. Following CDC5L knockdown, tumor volume steadily diminished, tumor mass shrank and tumor weight was correspondingly reduced. ELAVL1 overexpression reversed these effects. CDC5L competitively bound to ELAVL1 to inhibit the binding of ELAVL1 with mRNA, thereby regulating HCC pyroptosis. Finally, cellular and animal experiments confirmed that silencing CDC5L/ELAVL1 regulated Caspase 3/GSDME to promote HCC pyroptosis and inhibit tumor progression. In conclusion, CDC5L bound to ELAVL1 to inhibit pyroptosis in HCC through Caspase 3/GSDME signaling pathway, offering a promising therapeutic strategy for improving the prognosis and treatment of HCC.
🏷️ 키워드 / MeSH 📖 같은 키워드 OA만
- Carcinoma
- Hepatocellular
- Pyroptosis
- ELAV-Like Protein 1
- Humans
- Liver Neoplasms
- Signal Transduction
- Animals
- Caspase 3
- Cell Line
- Tumor
- Cell Cycle Proteins
- Mice
- Male
- Cell Proliferation
- Gene Expression Regulation
- Neoplastic
- Female
- Middle Aged
- Neoplasm Proteins
- Gasdermins
- RNA-Binding Proteins
- Caspase 3
- Caspase 3‑gasdermin E
… 외 4개
같은 제1저자의 인용 많은 논문 (5)
- Outcomes for metastatic triple-negative breast cancer patients treated with sacituzumab govitecan in clinical studies and real-world studies: a single-arm meta-analysis.
- Authors' reply to "Outcomes for metastatic triple-negative breast cancer patients treated with sacituzumab govitecan in clinical studies and real-world studies: a single-arm meta-analysis".
- A tumor-derived mitochondrial tsRNA drives vascular invasion of lung adenocarcinoma by promoting ribosomal assembly in endothelial cells.
- A streamlined technique for in-depth ubiquitomics analysis of formalin-fixed paraffin-embedded tissues.
- Rhein/Fe nanoassembly for triple-negative breast cancer treatment via a ferroptosis and immunogenic death.
📖 전문 본문 읽기 PMC JATS · ~66 KB · 영문
Introduction
Introduction
Hepatocellular carcinoma (HCC) is a prevalent malignant tumor globally, characterized by intricate survival mechanisms, elevated morbidity, unfavorable prognosis and significant cancer-related mortality (1,2). HCC commonly originates from conditions such as chronic hepatitis B and C infections, non-alcoholic fatty liver disease, heavy alcohol use and other causes that drive ongoing liver inflammation and the development of cirrhosis (3). Early diagnosis is essential to improving treatment options and reducing disease-related mortality (4). Of these patients ~30% are diagnosed with early-stage disease and are receiving potentially curative treatments, such as surgical resection, liver transplantation or local ablation, which result in a median overall survival of >60 months (5). However, the treatment of HCC, particularly advanced HCC, has been a serious challenge (6). Hence, it is crucial to delve into the pathogenesis of HCC and uncover effective treatment approaches.
Cell division cycle 5-like (CDC5L) is a key constituent of E3 ubiquitin ligase complex, which includes pre-mRNA processing factor 19 (PRP19), pleiotropic regulator 1 and BCAS2 pre-mRNA processing factor (7). This complex acts as a regulator of cell cycle, particularly during G2/M phase transition and is involved in the catalytic processes of pre-mRNA splicing and DNA damage repair (8). CDC5L has been shown to be markedly upregulated in HCC (9) and acts as an independent prognostic marker for unfavorable survival outcomes in patients with HCC (10). In addition, the phosphorylation of the CDC5L protein is involved in the metastasis of HCC (11). This indicates that CDC5L may play a significant role in HCC tumorigenesis and could serve as a promising therapeutic target to impede HCC progression. Predictive analysis based on the BioGRID 4.4 database (https://thebiogrid.org/107424/summary/homo-sapiens/cdc5l.html) showed that CDC5L interacts with the embryonic lethal abnormal visual-like protein (ELAVL1). ELAVL1 is a widely expressed in vivo protein that affects the target mRNA stability and participates in post-transcriptional regulation as an RNA-binding protein (12). The importance of ELAVL1-mediated cell signaling, inflammation, fibrosis and cancer development in the liver has attracted much attention (13). ELAVL1 has been shown to be upregulated in HCC and implicated in post-transcriptional regulation of multiple genes linked to the malignant transformation of the liver (14). However, the mechanism regarding the role of CDC5L and ELAVL1 in HCC is unclear.
Pyroptosis is an innate immune response characterized by its pro-inflammatory nature, driven by the accumulation of large plasma membrane pores composed of subunits of Gasdermin (GSDM) family proteins (15,16). When pathogens or other danger signals are detected, cytokine activity and the formation of inflammatory vesicles (cytoplasmic multiprotein complexes) trigger pyroptosis (17). Ultimately, this inflammatory cell death pathway results in cell lysis and inflammatory factors IL-1β and IL-18 release (18). There is growing evidence that, depending on the type of tumor, pyroptosis could either prevent or promote tumor progression (19). Pyroptosis has been shown to be crucial in various tissues and organs, including the liver (20) and it has potential as an effective target for treating HCC (21). Caspase 3 is a key protein that is shared between apoptosis and pyroptosis pathways (22). An elevated Caspase 3 activity in the liver has been observed in patients with various liver diseases (23). Research has shown that Caspase 3 deficiency markedly increased diethylnitrosamine-induced HCC (24). The effect of natural killer cells on pyroptosis in HepG2 cells treated with Schisandrin B is primarily due to their activation of the Caspase 3-gasdermin E (GSDME) pathway (25). Furthermore, both the small interfering (si)RNA-mediated knockdown of Caspase 3 and application of Caspase 3 inhibitor Z-Asp(OMe)-Glu(OMe)-Val-Asp(OMe)-ForwardMK reduced the induction of GSDME-dependent pyroptosis by Miltirone (26). An Encyclopedia of RNA Interactomes 3.0 database (https://rnasysu.com/encori/rbpClipRNA.php?source=mRNA&flag=target&clade=mammal&genome=human&assembly=hg38&RBP=ELAVL1&clipNum=1®ionType=None&pval=0.05&clipType=None&panNum=0&target=CASP3)-based analysis showed that ELAVL1 binds with Caspase 3. Therefore, the aim of the present study was to investigate whether the mechanisms underlying the effect of CDC5L and ELAVL1 in HCC pyroptosis involves Caspase 3. The core hypothesis was that CDC5L and ELAVL1 interact in the pyroptosis of HCC and this interaction may influence the expression of pyroptosis-related genes by regulating Caspase 3, thereby affecting the progression of HCC. Previous studies on CDC5L have mainly focused on its overexpression in HCC and its role as a prognostic factor for patient survival (9,10), as well as the role of its protein phosphorylation in HCC metastasis (11), while the mechanism of action of CDC5L in HCC pyroptosis remains unclear. Similarly, although it has been reported that ELAVL1 was overexpressed in HCC and was involved in the post-transcriptional regulation of genes related to hepatic malignant transformation (14), the specific role of ELAVL1 in HCC pyroptosis and its interaction mechanism with CDC5L are also not well understood. The present study focused on exploring the mechanism of action of CDC5L and ELAVL1 in HCC pyroptosis and whether they affect the pyroptosis process by regulating Caspase 3, which is a significant departure from previous studies that have only focused on the individual roles of CDC5L or ELAVL1.
Building upon the aforementioned, the high expression of CDC5L in HCC predicts poor prognosis (9,10). Therefore, the present study was designed to explore the function of CDC5L in HCC pyroptosis via both in vivo and in vitro experimental approaches. CDC5L may be a therapeutic target for HCC in the future. These results may offer novel perspectives and guidance for the treatment of HCC.
Hepatocellular carcinoma (HCC) is a prevalent malignant tumor globally, characterized by intricate survival mechanisms, elevated morbidity, unfavorable prognosis and significant cancer-related mortality (1,2). HCC commonly originates from conditions such as chronic hepatitis B and C infections, non-alcoholic fatty liver disease, heavy alcohol use and other causes that drive ongoing liver inflammation and the development of cirrhosis (3). Early diagnosis is essential to improving treatment options and reducing disease-related mortality (4). Of these patients ~30% are diagnosed with early-stage disease and are receiving potentially curative treatments, such as surgical resection, liver transplantation or local ablation, which result in a median overall survival of >60 months (5). However, the treatment of HCC, particularly advanced HCC, has been a serious challenge (6). Hence, it is crucial to delve into the pathogenesis of HCC and uncover effective treatment approaches.
Cell division cycle 5-like (CDC5L) is a key constituent of E3 ubiquitin ligase complex, which includes pre-mRNA processing factor 19 (PRP19), pleiotropic regulator 1 and BCAS2 pre-mRNA processing factor (7). This complex acts as a regulator of cell cycle, particularly during G2/M phase transition and is involved in the catalytic processes of pre-mRNA splicing and DNA damage repair (8). CDC5L has been shown to be markedly upregulated in HCC (9) and acts as an independent prognostic marker for unfavorable survival outcomes in patients with HCC (10). In addition, the phosphorylation of the CDC5L protein is involved in the metastasis of HCC (11). This indicates that CDC5L may play a significant role in HCC tumorigenesis and could serve as a promising therapeutic target to impede HCC progression. Predictive analysis based on the BioGRID 4.4 database (https://thebiogrid.org/107424/summary/homo-sapiens/cdc5l.html) showed that CDC5L interacts with the embryonic lethal abnormal visual-like protein (ELAVL1). ELAVL1 is a widely expressed in vivo protein that affects the target mRNA stability and participates in post-transcriptional regulation as an RNA-binding protein (12). The importance of ELAVL1-mediated cell signaling, inflammation, fibrosis and cancer development in the liver has attracted much attention (13). ELAVL1 has been shown to be upregulated in HCC and implicated in post-transcriptional regulation of multiple genes linked to the malignant transformation of the liver (14). However, the mechanism regarding the role of CDC5L and ELAVL1 in HCC is unclear.
Pyroptosis is an innate immune response characterized by its pro-inflammatory nature, driven by the accumulation of large plasma membrane pores composed of subunits of Gasdermin (GSDM) family proteins (15,16). When pathogens or other danger signals are detected, cytokine activity and the formation of inflammatory vesicles (cytoplasmic multiprotein complexes) trigger pyroptosis (17). Ultimately, this inflammatory cell death pathway results in cell lysis and inflammatory factors IL-1β and IL-18 release (18). There is growing evidence that, depending on the type of tumor, pyroptosis could either prevent or promote tumor progression (19). Pyroptosis has been shown to be crucial in various tissues and organs, including the liver (20) and it has potential as an effective target for treating HCC (21). Caspase 3 is a key protein that is shared between apoptosis and pyroptosis pathways (22). An elevated Caspase 3 activity in the liver has been observed in patients with various liver diseases (23). Research has shown that Caspase 3 deficiency markedly increased diethylnitrosamine-induced HCC (24). The effect of natural killer cells on pyroptosis in HepG2 cells treated with Schisandrin B is primarily due to their activation of the Caspase 3-gasdermin E (GSDME) pathway (25). Furthermore, both the small interfering (si)RNA-mediated knockdown of Caspase 3 and application of Caspase 3 inhibitor Z-Asp(OMe)-Glu(OMe)-Val-Asp(OMe)-ForwardMK reduced the induction of GSDME-dependent pyroptosis by Miltirone (26). An Encyclopedia of RNA Interactomes 3.0 database (https://rnasysu.com/encori/rbpClipRNA.php?source=mRNA&flag=target&clade=mammal&genome=human&assembly=hg38&RBP=ELAVL1&clipNum=1®ionType=None&pval=0.05&clipType=None&panNum=0&target=CASP3)-based analysis showed that ELAVL1 binds with Caspase 3. Therefore, the aim of the present study was to investigate whether the mechanisms underlying the effect of CDC5L and ELAVL1 in HCC pyroptosis involves Caspase 3. The core hypothesis was that CDC5L and ELAVL1 interact in the pyroptosis of HCC and this interaction may influence the expression of pyroptosis-related genes by regulating Caspase 3, thereby affecting the progression of HCC. Previous studies on CDC5L have mainly focused on its overexpression in HCC and its role as a prognostic factor for patient survival (9,10), as well as the role of its protein phosphorylation in HCC metastasis (11), while the mechanism of action of CDC5L in HCC pyroptosis remains unclear. Similarly, although it has been reported that ELAVL1 was overexpressed in HCC and was involved in the post-transcriptional regulation of genes related to hepatic malignant transformation (14), the specific role of ELAVL1 in HCC pyroptosis and its interaction mechanism with CDC5L are also not well understood. The present study focused on exploring the mechanism of action of CDC5L and ELAVL1 in HCC pyroptosis and whether they affect the pyroptosis process by regulating Caspase 3, which is a significant departure from previous studies that have only focused on the individual roles of CDC5L or ELAVL1.
Building upon the aforementioned, the high expression of CDC5L in HCC predicts poor prognosis (9,10). Therefore, the present study was designed to explore the function of CDC5L in HCC pyroptosis via both in vivo and in vitro experimental approaches. CDC5L may be a therapeutic target for HCC in the future. These results may offer novel perspectives and guidance for the treatment of HCC.
Materials and methods
Materials and methods
Clinical samples
HCC tissues and paracancerous tissues were collected from 10 participants diagnosed with HCC at Xiangya Hospital, Central South University (Hunan, China), through imaging, serological, or histopathological examinations. The sex ratio was 5 males to 5 females, with an age range of 43-76 years. Patients were recruited between January 1, 2024, and December 31, 2024. HCC and paracancerous tissues were collected and divided into the Tumor and Normal groups. Exclusion criteria were pathologically confirmed diagnosis of non-HCC and patients with incomplete clinical features. Informed consent was obtained from all participants and approval was obtained from the medical ethics committee of Xiangya Hospital, Central South University (Hunan, China; approval no. 2024052119).
Cell culture and treatment
The transformed human liver epithelial-2 (THLE-2) cells (CL-0833) were purchased from Procell Life Science & Technology Co., Ltd. SK-HEP-1 (AW-CCH036) and MHCC-97H (AW-CCH088) human liver cancer cells Huh7 (AW-CCH237), were purchased from Changsha Abiowell Biotechnology Co., Ltd. THLE-2 cells were cultured in THLE-2 Cell Complete Medium (CM-0833; Procell Life Science & Technology Co., Ltd.). Huh7, SK-HEP-1 or MHCC-97H cells were cultured in DMEM (containing NaHCO3 1.5 g/l), minimum essential medium or DMEM containing 10% fetal bovine serum and 1% penicillin/streptomycin. Logarithmically grown SK-HEP-1 and MHCC-97H cells were collected and spread inside a six-well plate and cells were processed following wall attachment. First, CDC5L was knocked down and divided into the Control, si-NC (negative control siRNA), si-CDC5L-1 (CDC5L-specific siRNA-1) and si-CDC5L-2 (CDC5L-specific siRNA-2) groups. CDC5L was overexpressed and divided into the si-NC, si-CDC5L, oe-NC (Negative control overexpression vector) and oe-CDC5L (CDC5L overexpression vector) groups. Caspase 3 was knocked down and divided into the si-NC, si-CDC5L, si-CDC5L+si-NC and si-CDC5L+si-Caspase 3 (Caspase 3-specific siRNA) groups. ELAVL1 was knocked down and divided into the Control, si-NC, si-ELAVL1#1 (ELAVL1-specific siRNA#1) and si-ELAVL1#2 (ELAVL1-specific siRNA#2) groups. ELAVL1 was overexpressed and divided into the si-NC, si-ELAVL1, oe-NC and oe-ELAVL1 (ELAVL1 overexpression vector) groups. Furthermore, groups were divided as follows: si-NC, si-CDC5L, si-CDC5L+oe-NC and si-CDC5L+oe-ELAVL1. Finally, GSDME was knocked down and divided into the Control, si-NC, si-GSDME#1 (GSDME-specific siRNA#1) and si-GSDME#2 (GSDME-specific siRNA#2) groups. SK-HEP-1 and MHCC-97H cells were treated with 1 μM CDC5L inhibitor CVT-313 (HY-15339; MedChemExpress) for 48 h (27) and divided into the following groups: Control, CVT-313, CVT-313 + si-NC and CVT-313 + si-GSDME (GSDME-specific siRNA). The transfection of all siRNA and overexpression vectors was carried out using Lipofectamine® 2000 (cat. no. 11668019; Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The siRNA was used at a concentration of 50 nM. Transfection was performed at 37°C for 48 h. The time interval between transfection and subsequent experimentation was 48 h. si-CDC5L (HG-SH001253), oe-CDC5L (HG-HO001253), si-ELAVL1-1 (HG-SH001419), oe-ELAVL1 (HG-HO001419), si-Caspase 3 (HG-SH032991), si-GSDME and (HG-SH004403) were obtained from HonorGene. The interference sequences are as follows: si-NC: TTAACGGCGAGAGTTTAGGCC, si-CDC5L-1: GGACAGAATTCTGCAGGAAGC, si-CDC5L-2: GCATAAAGCTGTCCAGAAAGA, si-ELAVL1-1: GGTTTGGGCGGATCATCAACT, si-ELAVL1-2: GAGGCAATTACCAGTTTCAAT, si-Caspase 3: GACAACAGTTATAAAATGGAT, si-GSDME: GAGAGGAATTTCCATCCATTT.
Tumor formation in nude mice
Male nude mice aged 4 weeks were supplied by Hunan SJA Laboratory Animal Co., Ltd. A total of 80 mice were used in this study. The mice were housed in a controlled environment with a temperature of 22±2°C, a 12-h light/dark cycle and humidity of 50±10%. The average weight of the mice was approximately 18-20 g at the start of the experiment. The tumor formation model of subcutaneous MHCC-97H cells in nude mice was established. Following a week of acclimatization and rearing, MHCC-97H cells were injected subcutaneously, with different treatment groups receiving corresponding cell types: si-NC, si-CDC5L, oe-NC and oe-CDC5L; si-NC, si-CDC5L, si-CDC5L+si-NC, si-CDC5L+si-Caspase 3; si-NC, si-CDC5L, si-CDC5L+oe-NC and si-CDC5L+oe-ELAVL1. Each nude mouse received an injection of 1×107 cells in a volume of 100 μl, administered into the left axillary region (28). In the si-NC group, mice were subcutaneously injected with si-NC-treated MHCC-97H cells. In the si-CDC5L group, mice were subcutaneously injected with si-CDC5L-treated MHCC-97H cells. In the oe-NC group, mice were subcutaneously injected with oe-NC-treated MHCC-97H cells. In the oe-CDC5L group, mice were subcutaneously injected with oe-CDC5L-treated MHCC-97H cells. In the si-CDC5L+si-NC group, mice were subcutaneously injected with si-CDC5L and si-NC-treated MHCC-97H cells. In the si-CDC5L+si-Caspase 3 group, mice were subcutaneously injected with si-CDC5L and si-Caspase 3-treated MHCC-97H cells. In the si-CDC5L+oe-NC group, mice were subcutaneously injected with si-CDC5L and oe-NC-treated MHCC-97H cells. In the si-CDC5L+oe-ELAVL1 group, mice were subcutaneously injected with si-CDC5L and oe-ELAVL1-treated MHCC-97H cells. Tumor dimensions were assessed twice weekly following implantation. When tumors grew to a diameter of 150-200 mm3, tumor volume and tumor weight were weighted and measured. Tumor volume was tracked and calculated using the formula: V (mm3)=LxW2/2, with L and W denoting the longest and shortest diameters, respectively. The study was terminated 28 days' post-implantation and the tumors were prepared for image capture. To perform sacrifice of mice using cervical dislocation, one hand used a rigid rod to firmly press down on the head and neck area, while the other hand grasped the tail or hind limbs. Then, quickly and forcefully the hindquarters were pulled backwards and upwards to dislocate the cervical vertebrae. Following cervical dislocation, the mice were observed for a ≤5 min to ensure that life was extinct. To determine whether life was extinct, its breathing and heartbeat were observed, while simultaneously checking the pupils and limb reflexes. If the mouse had stopped breathing and its heart had stopped beating following cervical dislocation, the pupils did not react to light and the limbs showed no reflex actions, it was more accurately confirmed that life was extinct.
In addition, following a week of acclimatization, 4-week-old male nude mice were injected subcutaneously with MHCC-97H cells and differently treated cells were injected into corresponding groups: Control, CVT-313, CVT-313 + si-NC and CVT-313 + si-GSDME. The amount of cells injected per nude mouse was 1×107 and a 100-μl volume was injected into the left axilla. Following tumor implantation, tumor measurements were conducted twice a week for observation. When the tumor grew to a suitable size (10 days after planting), the drug was administered in groups according to the tumor volume. Among them, mice in the Control group were subcutaneously injected with normal MHCC-97H cells. Nude mice in the CVT-313 group were subjected to CVT-313 drug intervention. Nude mice in the CVT-313 + si-NC group were injected subcutaneously with transfected si-NC-treated MHCC-97H cells and to CVT-313 drug intervention. Nude mice in the CVT-313 + si-GSDME group were subcutaneously injected with si-GSDME-treated MHCC-97H cells and underwent CVT-313 drug intervention. CVT-313 drug intervention was performed by intraperitoneal injection of CVT-313, administered every other day at a dose of 0.625 mg/Kg in an injection volume of 10 ml/100 g (29). The experiments were terminated after 28 days of tumor seeding and tumors were arranged to be sampled and images captured. All animal experiments were carried out with the approval of the Animal Ethics Committee of Xiangya Medical School, Central South University (approval no. 2024051707) and in compliance with the Declaration of Helsinki (30).
Bioinformatics analysis
Clinical specimens were categorized into HCC tissues and adjacent non-tumor tissues. Data were obtained from The Cancer Genome Atlas (TCGA, https://xenabrowser.net/datapages/?cohort=TCGA%20Pan-Cancer%20(PANCAN)&removeHub=https%3A%2F%2Fxena.treehouse.gi.ucsc.edu%3A443) data (369 tumor/50 normal). Box plots of differentially expressed CDC5L were drawn. Kaplan-Meier survival analysis was applied to assess the survival outcomes of patients with HCC in the high- and low-CDC5L groups. Gene Set Enrichment Analysis (GSEA; https://www.gsea-msigdb.org/gsea/index.jsp) was applied to explore Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway regulation. Bioinformatics analysis was conducted to the expression of evaluate Caspases 1, 3, 6, 7, 8, 9 and 10 in HCC. Venn diagrams displayed the intersection of CDC5L binding proteins and Caspase 3 interacting RNA-binding proteins (RBPs). Bioinformatics analysis was conducted to measure 22 RBPs levels in HCC. The binding of ELAVL1 with Caspase 3 was shown based on the University of California, Santa Cruz (UCSC) Genome Browser (http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr4%3A184627598%2D184627850&hgsid=2947477028_2O6buwujau0adLCDAGdFsuwkAUi0).
Cell function assays
Based on previous studies, the viability of SK-HEP-1 and MHCC-97H cells was evaluated using the Cell Counting Kit-8 (CCK-8) assay. Briefly, cells were seeded in 96-well plates at a density of 5,000 cells per well and incubated. The CCK-8 reagent (10 μl) was added to each well, and the plates were incubated for 2 h at 37°C. Absorbance was measured at 450 nm using a microplate reader. A clone formation assay was performed to assess the proliferative capacity of SK-HEP-1 and MHCC-97H cells (31). The migration and invasion of SK-HEP-1 and MHCC-97H cells was assessed through Transwell assays (32). For migration and invasion assays, 2×104 cells were seeded in the upper chamber of Transwell inserts with or without Matrigel coating. Transwell inserts were precoated with Matrigel and incubated at 37°C for 30 min. After 24 h, cells that migrated or invaded through the membrane were fixed with methanol and stained with 0.1% crystal violet at room temperature for 5 min. The number of cells was counted in five random fields under a light microscope.
Reverse transcription-quantitative (RT-q) PCR
CDC5L, Caspase 7, Caspase 9, Caspase 6, Caspase 8, Caspase 1, Caspase 3, Caspase 10, GSDME and CDC5L mRNA levels were quantified with RT-qPCR. Total RNA was isolated from cells at a density of 80-90% confluence using the TRIzol® Total RNA Extraction Kit (cat. no. 15596026; Thermo Fisher Scientific, Inc.) and its concentration and purity were evaluated. Subsequently, mRNA was reverse-transcribed into cDNA using mRNA Reverse Transcription Kit (cat. no. CW2569; CWBIO) according to the manufacturer's protocol. Target genes levels were determined on ABI 7900 system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using Ultra SYBR Mixture (CW2601; CWBIO) and calculated by 2−ΔΔCq method (33), with β-actin serving as internal reference gene. The PCR cycling conditions were as follows: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, and 72°C for 30 sec. The experiments were replicated three times. The primer sequences used are listed in Table I.
Western blotting
Western blotting was applied to assess CDC5L, GSDME, Gasdermin E N-terminal fragment (GSDME-N), Caspase 1, 3, 6, 7, 8, 9 and 10, KH RNA binding domain containing, signal transduction associated 1 (KHDRBS1), nudix hydrolase 21 (NUDT21), heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), RNA binding motif protein X-linked (RBMX), heterogeneous nuclear ribonucleoprotein C (HNRNPC) and ELAVL1 expressions. Total proteins were extracted using RIPA buffer (cat. no. AWB0136; Changsha Abiowell Biotechnology Co., Ltd.). The protein concentration was determined using the BCA Protein Assay Kit (cat. no. 23225; Thermo Fisher Scientific, Inc.). A total of 30 μg of protein was loaded per lane. The proteins were separated via SDS-PAGE using a 10% gel and transferred onto nitrocellulose membranes. Membranes were blocked with 5% skimmed milk at room temperature for 1.5 h, followed by incubation with primary antibodies overnight at 4°C. The primary antibodies used were: CDC5L (cat. no. 12974-1-AP; 1:1,000; Proteintech Group, Inc.), GSDME (cat. no. ab215191; 1:1,000; Abcam), GSDME-N (cat. no. ab222408; 1:1,000; Abcam), Caspase-7 (cat. no. ab25900; 1:1,000; Abcam), Caspase-9 (cat. no. ab2013; 1:2,000; Abcam), Caspase-6 (cat. no. ab52951; 1:20,000; Abcam Plc), Caspase-8 (cat. no. ab227430; 1:1,000; Abcam), Caspase-1 (cat. no. ab286125; 1:1,000; Abcam), Caspase 3 (cat. no. 19677-1-AP; 1:1,000; Proteintech Group, Inc.), Caspase-10 (cat. no. ab2012; 1:2,000; Abcam), KHDRBS1 (cat. no. 10222-1-AP; 1:3,000; Proteintech Group, Inc.), NUDT21 (cat. no. 10322-1-AP; 1:5,000; Proteintech Group, Inc.), HNRNPA2B1 (cat. no. 67445-1-Ig; 1:8,000; Proteintech Group, Inc.), RBMX (cat. no. ab250272; 1:1,000; Abcam), HNRNPC (cat. no. ab133607; 1:20,000; Abcam), ELAVL1 (cat. no. ab238528; dilution, 1:1,000; Abcam) and β-actin (cat. no. AWA80002; 1:5,000; Changsha Abiowell Biotechnology Co., Ltd.). Membranes were incubated with HRP goat anti-mouse/rabbit IgG (cat. no. SA00001-1/SA00001-2; 1:5,000/1:6,000; Proteintech Group, Inc.) at room temperature for 1.5 h. Next, membranes were treated with an ECL reagent (cat. no. AWB0005, Changsha Abiowell Biotechnology Co., Ltd.) for 1 min and then subjected to analysis using an imaging system (Bio-Rad ChemiDoc MP, Bio-Rad Laboratories, Inc.). The protein levels were quantified by Quantity One 4.6.6 software (Bio-Rad Laboratories, Inc.), with β-actin serving as internal control.
Biochemical detection
Lactate Dehydrogenase (LDH), IL-1β and IL-18 levels were assessed using LDH Assay Kit (cat. no. A020-2; Nanjing Jiancheng Bioengineering Institute), IL-1β Assay Kit (human; cat. no. KE00021; Proteintech Group, Inc.; mouse; cat. no. KE10003; Proteintech Group, Inc.) and IL-18 Assay Kit (human: cat. no. KE00193; Proteintech Group, Inc.; mouse; cat. no. CSB-E04609m; Wuhan Huamei Biotech Co., Ltd.) according to the instructions.
Half-life of Caspase 3 mRNA
In cells with overexpression/knockdown of ELAVL1, the half-life of Caspase 3 mRNA was assessed using RT-qPCR following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8 and 10 h. In addition, in cells where CDC5L was knocked down and ELAVL1 was overexpressed, RT-qPCR was employed to measure Caspase 3 mRNA expression following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8 and 10 h, in order to determine the half-life of Caspase 3 mRNA.
Hoechst 33342 and propidium iodide (PI) staining
Hoechst 33342 and PI staining was performed to observe pyroptosis. Following the corresponding time of the aforementioned treatments, cells in each group were washed once with PBS, followed by the addition of 1 ml of cell staining buffer. Subsequently, 5 μl of Hoechst 33342 staining solution and 5 μl of PI staining solution were added to the cells. Cells were then gently mixed and incubated for 30 min at 4°C. The staining status of each group of cells was viewed under a microscope and then the fluorescence status of each group was viewed under a microscope and images captured.
Co-immunoprecipitation (Co-IP)
In order to investigate interaction between CDC5L and ELAVL1, Co-IP experiments were conducted. SK-HEP-1 and MHCC-97H cells were collected for protein extraction. The cells were lysed in a lysis buffer containing protease inhibitors at 4°C for 30 min. The lysate was cleared by centrifugation at 14,000 × g for 10 min at 4°C. The protein concentration was determined using the BCA protein assay kit (cat. no. 23225; Thermo Fisher Scientific, Inc.). For each immunoprecipitation reaction, 500 μg of protein lysate was incubated with 2 μg of CDC5L antibody (cat. no. 12974-1-AP; Proteintech Group, Inc.) in a total volume of 500 μl of lysis buffer at 4°C overnight. Subsequently, 30 μl of Protein A/G agarose beads (cat. no. sc-2003; Santa Cruz Biotechnology, Inc.) added to IP mixture and allowed to incubate for 2 h at 4°C. The beads were washed three times with 1 ml of lysis buffer to remove nonspecific binding. The entire immunoprecipitate was eluted by boiling in 50 μl of 2X SDS-PAGE loading buffer for 10 min at 95°C. The eluted proteins were separated by SDS-PAGE using a 10% polyacrylamide gel and transferred onto nitrocellulose membrane. Membranes were blocked with 5% skimmed milk at room temperature for 1.5 h. The membrane was probed with primary antibodies against CDC5L (cat. no. 12974-1-AP; dilution, 1:1,000; Proteintech Group, Inc.) and ELAVL1 (cat. no. AWA48828; dilution, 1:1,000; Changsha Abiowell Biotechnology Co., Ltd.) overnight at 4°C. Membranes were incubated with HRP goat anti-rabbit IgG (cat. no. SA00001-2; 1:6,000; Proteintech Group, Inc.) for 1.5 h. Next, membranes were treated with an ECL reagent (cat. no. AWB0005, Changsha Abiowell Biotechnology Co., Ltd.) for 1 min and then subjected to analysis using an imaging system (Bio-Rad ChemiDoc MP, Bio-Rad Laboratories, Inc.). The protein levels were quantified by Quantity One 4.6.6 software (Bio-Rad Laboratories, Inc.).
RNA immunoprecipitation (RIP) assay
Cell RNA-binding proteins were immunoprecipitated and fluorescence quantification was performed to detect whether CDC5L (cat. no. 12974-1-AP; Proteintech Group, Inc.) or ELAVL1 (cat. no. 11910-1-AP; Proteintech Group, Inc.) binds to Caspase 3. Briefly, cells were lysed using RIP lysis buffer at 4°C for 30 min. The lysate was cleared by centrifugation at 14,000 × g for 10 min at 4°C. For each immunoprecipitation reaction, 100 μl of cell lysate was incubated with 50 μl of magnetic beads coated with Protein A (according to the manufacturer's protocol) in RIP buffer for 2 h at 4°C. The beads were washed three times with RIP buffer. The isolated RNA was subjected to RT-qPCR analysis, with total RNA used as input controls. Primer sequences were H-Caspase 3, TGG CAACAGAATTTGAGTCCT forward and H-Caspase 3, ACCATCTTCTCACTTGGCAT reverse.
Statistical analysis
Data analysis was conducted using GraphPad Prism 8.0 software (Dotmatics). Results are presented as the mean ± standard deviation. For comparisons between two groups, Student's unpaired t-test was used, whereas for multiple group comparisons, one-way ANOVA followed by Tukey's post-hoc test was applied. P<0.05 was considered to indicate a statistically significant difference.
Clinical samples
HCC tissues and paracancerous tissues were collected from 10 participants diagnosed with HCC at Xiangya Hospital, Central South University (Hunan, China), through imaging, serological, or histopathological examinations. The sex ratio was 5 males to 5 females, with an age range of 43-76 years. Patients were recruited between January 1, 2024, and December 31, 2024. HCC and paracancerous tissues were collected and divided into the Tumor and Normal groups. Exclusion criteria were pathologically confirmed diagnosis of non-HCC and patients with incomplete clinical features. Informed consent was obtained from all participants and approval was obtained from the medical ethics committee of Xiangya Hospital, Central South University (Hunan, China; approval no. 2024052119).
Cell culture and treatment
The transformed human liver epithelial-2 (THLE-2) cells (CL-0833) were purchased from Procell Life Science & Technology Co., Ltd. SK-HEP-1 (AW-CCH036) and MHCC-97H (AW-CCH088) human liver cancer cells Huh7 (AW-CCH237), were purchased from Changsha Abiowell Biotechnology Co., Ltd. THLE-2 cells were cultured in THLE-2 Cell Complete Medium (CM-0833; Procell Life Science & Technology Co., Ltd.). Huh7, SK-HEP-1 or MHCC-97H cells were cultured in DMEM (containing NaHCO3 1.5 g/l), minimum essential medium or DMEM containing 10% fetal bovine serum and 1% penicillin/streptomycin. Logarithmically grown SK-HEP-1 and MHCC-97H cells were collected and spread inside a six-well plate and cells were processed following wall attachment. First, CDC5L was knocked down and divided into the Control, si-NC (negative control siRNA), si-CDC5L-1 (CDC5L-specific siRNA-1) and si-CDC5L-2 (CDC5L-specific siRNA-2) groups. CDC5L was overexpressed and divided into the si-NC, si-CDC5L, oe-NC (Negative control overexpression vector) and oe-CDC5L (CDC5L overexpression vector) groups. Caspase 3 was knocked down and divided into the si-NC, si-CDC5L, si-CDC5L+si-NC and si-CDC5L+si-Caspase 3 (Caspase 3-specific siRNA) groups. ELAVL1 was knocked down and divided into the Control, si-NC, si-ELAVL1#1 (ELAVL1-specific siRNA#1) and si-ELAVL1#2 (ELAVL1-specific siRNA#2) groups. ELAVL1 was overexpressed and divided into the si-NC, si-ELAVL1, oe-NC and oe-ELAVL1 (ELAVL1 overexpression vector) groups. Furthermore, groups were divided as follows: si-NC, si-CDC5L, si-CDC5L+oe-NC and si-CDC5L+oe-ELAVL1. Finally, GSDME was knocked down and divided into the Control, si-NC, si-GSDME#1 (GSDME-specific siRNA#1) and si-GSDME#2 (GSDME-specific siRNA#2) groups. SK-HEP-1 and MHCC-97H cells were treated with 1 μM CDC5L inhibitor CVT-313 (HY-15339; MedChemExpress) for 48 h (27) and divided into the following groups: Control, CVT-313, CVT-313 + si-NC and CVT-313 + si-GSDME (GSDME-specific siRNA). The transfection of all siRNA and overexpression vectors was carried out using Lipofectamine® 2000 (cat. no. 11668019; Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The siRNA was used at a concentration of 50 nM. Transfection was performed at 37°C for 48 h. The time interval between transfection and subsequent experimentation was 48 h. si-CDC5L (HG-SH001253), oe-CDC5L (HG-HO001253), si-ELAVL1-1 (HG-SH001419), oe-ELAVL1 (HG-HO001419), si-Caspase 3 (HG-SH032991), si-GSDME and (HG-SH004403) were obtained from HonorGene. The interference sequences are as follows: si-NC: TTAACGGCGAGAGTTTAGGCC, si-CDC5L-1: GGACAGAATTCTGCAGGAAGC, si-CDC5L-2: GCATAAAGCTGTCCAGAAAGA, si-ELAVL1-1: GGTTTGGGCGGATCATCAACT, si-ELAVL1-2: GAGGCAATTACCAGTTTCAAT, si-Caspase 3: GACAACAGTTATAAAATGGAT, si-GSDME: GAGAGGAATTTCCATCCATTT.
Tumor formation in nude mice
Male nude mice aged 4 weeks were supplied by Hunan SJA Laboratory Animal Co., Ltd. A total of 80 mice were used in this study. The mice were housed in a controlled environment with a temperature of 22±2°C, a 12-h light/dark cycle and humidity of 50±10%. The average weight of the mice was approximately 18-20 g at the start of the experiment. The tumor formation model of subcutaneous MHCC-97H cells in nude mice was established. Following a week of acclimatization and rearing, MHCC-97H cells were injected subcutaneously, with different treatment groups receiving corresponding cell types: si-NC, si-CDC5L, oe-NC and oe-CDC5L; si-NC, si-CDC5L, si-CDC5L+si-NC, si-CDC5L+si-Caspase 3; si-NC, si-CDC5L, si-CDC5L+oe-NC and si-CDC5L+oe-ELAVL1. Each nude mouse received an injection of 1×107 cells in a volume of 100 μl, administered into the left axillary region (28). In the si-NC group, mice were subcutaneously injected with si-NC-treated MHCC-97H cells. In the si-CDC5L group, mice were subcutaneously injected with si-CDC5L-treated MHCC-97H cells. In the oe-NC group, mice were subcutaneously injected with oe-NC-treated MHCC-97H cells. In the oe-CDC5L group, mice were subcutaneously injected with oe-CDC5L-treated MHCC-97H cells. In the si-CDC5L+si-NC group, mice were subcutaneously injected with si-CDC5L and si-NC-treated MHCC-97H cells. In the si-CDC5L+si-Caspase 3 group, mice were subcutaneously injected with si-CDC5L and si-Caspase 3-treated MHCC-97H cells. In the si-CDC5L+oe-NC group, mice were subcutaneously injected with si-CDC5L and oe-NC-treated MHCC-97H cells. In the si-CDC5L+oe-ELAVL1 group, mice were subcutaneously injected with si-CDC5L and oe-ELAVL1-treated MHCC-97H cells. Tumor dimensions were assessed twice weekly following implantation. When tumors grew to a diameter of 150-200 mm3, tumor volume and tumor weight were weighted and measured. Tumor volume was tracked and calculated using the formula: V (mm3)=LxW2/2, with L and W denoting the longest and shortest diameters, respectively. The study was terminated 28 days' post-implantation and the tumors were prepared for image capture. To perform sacrifice of mice using cervical dislocation, one hand used a rigid rod to firmly press down on the head and neck area, while the other hand grasped the tail or hind limbs. Then, quickly and forcefully the hindquarters were pulled backwards and upwards to dislocate the cervical vertebrae. Following cervical dislocation, the mice were observed for a ≤5 min to ensure that life was extinct. To determine whether life was extinct, its breathing and heartbeat were observed, while simultaneously checking the pupils and limb reflexes. If the mouse had stopped breathing and its heart had stopped beating following cervical dislocation, the pupils did not react to light and the limbs showed no reflex actions, it was more accurately confirmed that life was extinct.
In addition, following a week of acclimatization, 4-week-old male nude mice were injected subcutaneously with MHCC-97H cells and differently treated cells were injected into corresponding groups: Control, CVT-313, CVT-313 + si-NC and CVT-313 + si-GSDME. The amount of cells injected per nude mouse was 1×107 and a 100-μl volume was injected into the left axilla. Following tumor implantation, tumor measurements were conducted twice a week for observation. When the tumor grew to a suitable size (10 days after planting), the drug was administered in groups according to the tumor volume. Among them, mice in the Control group were subcutaneously injected with normal MHCC-97H cells. Nude mice in the CVT-313 group were subjected to CVT-313 drug intervention. Nude mice in the CVT-313 + si-NC group were injected subcutaneously with transfected si-NC-treated MHCC-97H cells and to CVT-313 drug intervention. Nude mice in the CVT-313 + si-GSDME group were subcutaneously injected with si-GSDME-treated MHCC-97H cells and underwent CVT-313 drug intervention. CVT-313 drug intervention was performed by intraperitoneal injection of CVT-313, administered every other day at a dose of 0.625 mg/Kg in an injection volume of 10 ml/100 g (29). The experiments were terminated after 28 days of tumor seeding and tumors were arranged to be sampled and images captured. All animal experiments were carried out with the approval of the Animal Ethics Committee of Xiangya Medical School, Central South University (approval no. 2024051707) and in compliance with the Declaration of Helsinki (30).
Bioinformatics analysis
Clinical specimens were categorized into HCC tissues and adjacent non-tumor tissues. Data were obtained from The Cancer Genome Atlas (TCGA, https://xenabrowser.net/datapages/?cohort=TCGA%20Pan-Cancer%20(PANCAN)&removeHub=https%3A%2F%2Fxena.treehouse.gi.ucsc.edu%3A443) data (369 tumor/50 normal). Box plots of differentially expressed CDC5L were drawn. Kaplan-Meier survival analysis was applied to assess the survival outcomes of patients with HCC in the high- and low-CDC5L groups. Gene Set Enrichment Analysis (GSEA; https://www.gsea-msigdb.org/gsea/index.jsp) was applied to explore Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway regulation. Bioinformatics analysis was conducted to the expression of evaluate Caspases 1, 3, 6, 7, 8, 9 and 10 in HCC. Venn diagrams displayed the intersection of CDC5L binding proteins and Caspase 3 interacting RNA-binding proteins (RBPs). Bioinformatics analysis was conducted to measure 22 RBPs levels in HCC. The binding of ELAVL1 with Caspase 3 was shown based on the University of California, Santa Cruz (UCSC) Genome Browser (http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr4%3A184627598%2D184627850&hgsid=2947477028_2O6buwujau0adLCDAGdFsuwkAUi0).
Cell function assays
Based on previous studies, the viability of SK-HEP-1 and MHCC-97H cells was evaluated using the Cell Counting Kit-8 (CCK-8) assay. Briefly, cells were seeded in 96-well plates at a density of 5,000 cells per well and incubated. The CCK-8 reagent (10 μl) was added to each well, and the plates were incubated for 2 h at 37°C. Absorbance was measured at 450 nm using a microplate reader. A clone formation assay was performed to assess the proliferative capacity of SK-HEP-1 and MHCC-97H cells (31). The migration and invasion of SK-HEP-1 and MHCC-97H cells was assessed through Transwell assays (32). For migration and invasion assays, 2×104 cells were seeded in the upper chamber of Transwell inserts with or without Matrigel coating. Transwell inserts were precoated with Matrigel and incubated at 37°C for 30 min. After 24 h, cells that migrated or invaded through the membrane were fixed with methanol and stained with 0.1% crystal violet at room temperature for 5 min. The number of cells was counted in five random fields under a light microscope.
Reverse transcription-quantitative (RT-q) PCR
CDC5L, Caspase 7, Caspase 9, Caspase 6, Caspase 8, Caspase 1, Caspase 3, Caspase 10, GSDME and CDC5L mRNA levels were quantified with RT-qPCR. Total RNA was isolated from cells at a density of 80-90% confluence using the TRIzol® Total RNA Extraction Kit (cat. no. 15596026; Thermo Fisher Scientific, Inc.) and its concentration and purity were evaluated. Subsequently, mRNA was reverse-transcribed into cDNA using mRNA Reverse Transcription Kit (cat. no. CW2569; CWBIO) according to the manufacturer's protocol. Target genes levels were determined on ABI 7900 system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using Ultra SYBR Mixture (CW2601; CWBIO) and calculated by 2−ΔΔCq method (33), with β-actin serving as internal reference gene. The PCR cycling conditions were as follows: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, and 72°C for 30 sec. The experiments were replicated three times. The primer sequences used are listed in Table I.
Western blotting
Western blotting was applied to assess CDC5L, GSDME, Gasdermin E N-terminal fragment (GSDME-N), Caspase 1, 3, 6, 7, 8, 9 and 10, KH RNA binding domain containing, signal transduction associated 1 (KHDRBS1), nudix hydrolase 21 (NUDT21), heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), RNA binding motif protein X-linked (RBMX), heterogeneous nuclear ribonucleoprotein C (HNRNPC) and ELAVL1 expressions. Total proteins were extracted using RIPA buffer (cat. no. AWB0136; Changsha Abiowell Biotechnology Co., Ltd.). The protein concentration was determined using the BCA Protein Assay Kit (cat. no. 23225; Thermo Fisher Scientific, Inc.). A total of 30 μg of protein was loaded per lane. The proteins were separated via SDS-PAGE using a 10% gel and transferred onto nitrocellulose membranes. Membranes were blocked with 5% skimmed milk at room temperature for 1.5 h, followed by incubation with primary antibodies overnight at 4°C. The primary antibodies used were: CDC5L (cat. no. 12974-1-AP; 1:1,000; Proteintech Group, Inc.), GSDME (cat. no. ab215191; 1:1,000; Abcam), GSDME-N (cat. no. ab222408; 1:1,000; Abcam), Caspase-7 (cat. no. ab25900; 1:1,000; Abcam), Caspase-9 (cat. no. ab2013; 1:2,000; Abcam), Caspase-6 (cat. no. ab52951; 1:20,000; Abcam Plc), Caspase-8 (cat. no. ab227430; 1:1,000; Abcam), Caspase-1 (cat. no. ab286125; 1:1,000; Abcam), Caspase 3 (cat. no. 19677-1-AP; 1:1,000; Proteintech Group, Inc.), Caspase-10 (cat. no. ab2012; 1:2,000; Abcam), KHDRBS1 (cat. no. 10222-1-AP; 1:3,000; Proteintech Group, Inc.), NUDT21 (cat. no. 10322-1-AP; 1:5,000; Proteintech Group, Inc.), HNRNPA2B1 (cat. no. 67445-1-Ig; 1:8,000; Proteintech Group, Inc.), RBMX (cat. no. ab250272; 1:1,000; Abcam), HNRNPC (cat. no. ab133607; 1:20,000; Abcam), ELAVL1 (cat. no. ab238528; dilution, 1:1,000; Abcam) and β-actin (cat. no. AWA80002; 1:5,000; Changsha Abiowell Biotechnology Co., Ltd.). Membranes were incubated with HRP goat anti-mouse/rabbit IgG (cat. no. SA00001-1/SA00001-2; 1:5,000/1:6,000; Proteintech Group, Inc.) at room temperature for 1.5 h. Next, membranes were treated with an ECL reagent (cat. no. AWB0005, Changsha Abiowell Biotechnology Co., Ltd.) for 1 min and then subjected to analysis using an imaging system (Bio-Rad ChemiDoc MP, Bio-Rad Laboratories, Inc.). The protein levels were quantified by Quantity One 4.6.6 software (Bio-Rad Laboratories, Inc.), with β-actin serving as internal control.
Biochemical detection
Lactate Dehydrogenase (LDH), IL-1β and IL-18 levels were assessed using LDH Assay Kit (cat. no. A020-2; Nanjing Jiancheng Bioengineering Institute), IL-1β Assay Kit (human; cat. no. KE00021; Proteintech Group, Inc.; mouse; cat. no. KE10003; Proteintech Group, Inc.) and IL-18 Assay Kit (human: cat. no. KE00193; Proteintech Group, Inc.; mouse; cat. no. CSB-E04609m; Wuhan Huamei Biotech Co., Ltd.) according to the instructions.
Half-life of Caspase 3 mRNA
In cells with overexpression/knockdown of ELAVL1, the half-life of Caspase 3 mRNA was assessed using RT-qPCR following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8 and 10 h. In addition, in cells where CDC5L was knocked down and ELAVL1 was overexpressed, RT-qPCR was employed to measure Caspase 3 mRNA expression following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8 and 10 h, in order to determine the half-life of Caspase 3 mRNA.
Hoechst 33342 and propidium iodide (PI) staining
Hoechst 33342 and PI staining was performed to observe pyroptosis. Following the corresponding time of the aforementioned treatments, cells in each group were washed once with PBS, followed by the addition of 1 ml of cell staining buffer. Subsequently, 5 μl of Hoechst 33342 staining solution and 5 μl of PI staining solution were added to the cells. Cells were then gently mixed and incubated for 30 min at 4°C. The staining status of each group of cells was viewed under a microscope and then the fluorescence status of each group was viewed under a microscope and images captured.
Co-immunoprecipitation (Co-IP)
In order to investigate interaction between CDC5L and ELAVL1, Co-IP experiments were conducted. SK-HEP-1 and MHCC-97H cells were collected for protein extraction. The cells were lysed in a lysis buffer containing protease inhibitors at 4°C for 30 min. The lysate was cleared by centrifugation at 14,000 × g for 10 min at 4°C. The protein concentration was determined using the BCA protein assay kit (cat. no. 23225; Thermo Fisher Scientific, Inc.). For each immunoprecipitation reaction, 500 μg of protein lysate was incubated with 2 μg of CDC5L antibody (cat. no. 12974-1-AP; Proteintech Group, Inc.) in a total volume of 500 μl of lysis buffer at 4°C overnight. Subsequently, 30 μl of Protein A/G agarose beads (cat. no. sc-2003; Santa Cruz Biotechnology, Inc.) added to IP mixture and allowed to incubate for 2 h at 4°C. The beads were washed three times with 1 ml of lysis buffer to remove nonspecific binding. The entire immunoprecipitate was eluted by boiling in 50 μl of 2X SDS-PAGE loading buffer for 10 min at 95°C. The eluted proteins were separated by SDS-PAGE using a 10% polyacrylamide gel and transferred onto nitrocellulose membrane. Membranes were blocked with 5% skimmed milk at room temperature for 1.5 h. The membrane was probed with primary antibodies against CDC5L (cat. no. 12974-1-AP; dilution, 1:1,000; Proteintech Group, Inc.) and ELAVL1 (cat. no. AWA48828; dilution, 1:1,000; Changsha Abiowell Biotechnology Co., Ltd.) overnight at 4°C. Membranes were incubated with HRP goat anti-rabbit IgG (cat. no. SA00001-2; 1:6,000; Proteintech Group, Inc.) for 1.5 h. Next, membranes were treated with an ECL reagent (cat. no. AWB0005, Changsha Abiowell Biotechnology Co., Ltd.) for 1 min and then subjected to analysis using an imaging system (Bio-Rad ChemiDoc MP, Bio-Rad Laboratories, Inc.). The protein levels were quantified by Quantity One 4.6.6 software (Bio-Rad Laboratories, Inc.).
RNA immunoprecipitation (RIP) assay
Cell RNA-binding proteins were immunoprecipitated and fluorescence quantification was performed to detect whether CDC5L (cat. no. 12974-1-AP; Proteintech Group, Inc.) or ELAVL1 (cat. no. 11910-1-AP; Proteintech Group, Inc.) binds to Caspase 3. Briefly, cells were lysed using RIP lysis buffer at 4°C for 30 min. The lysate was cleared by centrifugation at 14,000 × g for 10 min at 4°C. For each immunoprecipitation reaction, 100 μl of cell lysate was incubated with 50 μl of magnetic beads coated with Protein A (according to the manufacturer's protocol) in RIP buffer for 2 h at 4°C. The beads were washed three times with RIP buffer. The isolated RNA was subjected to RT-qPCR analysis, with total RNA used as input controls. Primer sequences were H-Caspase 3, TGG CAACAGAATTTGAGTCCT forward and H-Caspase 3, ACCATCTTCTCACTTGGCAT reverse.
Statistical analysis
Data analysis was conducted using GraphPad Prism 8.0 software (Dotmatics). Results are presented as the mean ± standard deviation. For comparisons between two groups, Student's unpaired t-test was used, whereas for multiple group comparisons, one-way ANOVA followed by Tukey's post-hoc test was applied. P<0.05 was considered to indicate a statistically significant difference.
Results
Results
CDC5L expression is elevated in HCC
First, CDC5L expression was analyzed in HCC based on the TCGA database. CDC5L exhibited high expression levels in the Tumor group compared with the Normal group (Fig. 1A). In addition, Kaplan-Meier survival analysis demonstrated that the overall survival time of patients with HCC in the high-CDC5L group was shorter, as compared with the low-CDC5L group (Fig. 1B). GSEA analysis showed that CDC5L was mainly enriched in Transcriptional Misregulation In Cancer [Normalized Enrichment Score (NES)=1.45; P<0.001; Fig. 1C]. Moreover, the functional pathways of highly expressed CDC5L involved the MAPK signaling pathway, PI3K-Akt signaling pathway, Wnt signaling pathway and others (Table SI). Next, western blot analysis further revealed CDC5L expression in clinical tissues. CDC5L expression was elevated in the HCC group compared with the paracancerous tissue group (Fig. 1D). In addition, CDC5L expression was further validated at the cellular level. CDC5L expression was elevated in human liver cancer cells (Huh7, SK-HEP-1 and MHCC-97H cells) compared with THLE-2 cells. Among them, CDC5L expression was most markedly elevated in SK-HEP-1 and MHCC-97H cells (Fig. 1E and F) and was therefore selected for subsequent experimental studies. The present results indicated that CDC5L expression was upregulated in HCC.
CDC5L regulates HCC pyroptosis
Next, CDC5L was knocked down. Compared with the si-NC group, CDC5L levels were reduced in the si-CDC5L-1 and si-CDC5L-2 groups. Among them, the si-CDC5L-2 group exhibited the most obvious reduction in CDC5L expression (Fig. 2A) and was therefore selected for subsequent experimental studies. Furthermore, CDC5L was overexpressed. For cells transfected with oe-CDC5L alone, RT-qPCR results showed a significant increase in CDC5L mRNA expression, indicating that oe-CDC5L transfection successfully achieved overexpression of CDC5L (Fig. 2B). CDC5L knockdown repressed cell viability, proliferation, migration and invasion, but CDC5L overexpression facilitated cell viability, proliferation, migration and invasion (Fig. 2C-E). In addition, CDC5L knockdown promoted LDH levels, PI positive rate, GSDME and GSDME-N levels and IL-18 and IL-1β levels. CDC5L overexpression suppressed LDH levels, PI positive rate, GSDME and GSDME-N levels and IL-18 and IL-1β levels (Fig. 3A-D). Moreover, the effects of low and high CDC5L expression was verified in HCC in vivo. It was found that, following CDC5L knockdown, the tumor volume was gradually reduced, along with reductions in tumor size and weight. Conversely, following CDC5L overexpression, the tumor volume gradually increased and both tumor size and weight grew larger (Fig. 4A-C). In addition, IL-18 and IL-1β levels were elevated following CDC5L knockdown. By contrast, these cytokine levels were diminished following CDC5L overexpression (Fig. 4D). CDC5L knockdown promoted GSDME and GSDME-N levels but repressed CDC5L levels. CDC5L overexpression suppressed GSDME and GSDME-N levels but elevated CDC5L levels (Fig. 4E). These results indicated that CDC5L regulated HCC pyroptosis.
The regulation of CDC5L on pyroptosis of HCC depends on the Caspase family
Based on GeneCards search results, Caspases 1-10 were seen to be involved in the progression of HCC. The Caspase family genes common to both the high and low expression groups of CDC5L were Caspases 1, 2, 3, 6, 7, 8, 9 and 10. According to GeneCards search results, among them, Caspases 1, 3, 6, 7, 8, 9 and 10 mediated the process of pyroptosis (Fig. 5A). The expression of Caspases 1, 3, 6, 7, 8, 9 and 10 was validated using RT-qPCR and western blotting. Caspase 3, a key protein involved in both pyroptosis and apoptosis, exerted tumor cytotoxicity via GSDME upon activation (34). Combining the results of mRNA and protein, it was observed CDC5L knockdown substantially elevated Caspase 3 expression, but CDC5L overexpression result in a markedly reduction in Caspase 3 expression (Fig. 5B). Therefore, Caspase 3 was selected for subsequent experiments. RIP was further used to detect the binding of CDC5L to Caspase 3 mRNA. The results showed that CDC5L did not bind to Caspase 3 mRNA (Fig. 5C). Next, Caspase 3 was used to interfere. For cells transfected with si-Caspase 3 alone, RT-qPCR results showed that compared with the si-NC group, the expression of Caspase 3 mRNA was markedly reduced in both the si-Caspase 3#1 and si-Caspase 3#2 groups. Among them, the si-Caspase 3#2 group exhibited the most pronounced reduction in Caspase 3 mRNA expression and was used for subsequent experiments. This indicated that si-Caspase 3 transfection successfully achieved knockdown of Caspase 3 (Fig. 5D). Compared with the si-NC group, si-CDC5L group exhibited a reduced the expression of CDC5L and increased the expression of Caspase 3. Upon the additional knockdown of Caspase 3, its expression decreased, while CDC5L expression remained largely unchanged (Fig. 5E). Cellular function experiments showed that, compared with si-NC group, cell viability, proliferation, migration and invasion capabilities in the si-CDC5L group were diminished. Following the further knockdown of Caspase 3, cell viability, proliferation, migration and invasion capabilities increased (Figs. 5F and 6A-B). In addition, compared with the si-NC group, LDH, IL-18 and IL-1β levels, PI positive rate and GSDME and GSDME-N protein levels in the si-CDC5L group increased. Following the further knockdown of Caspase 3, LDH, IL-18 and IL-1β levels decreased, PI positive rate decreased and GSDME and GSDME-N protein levels decreased (Figs. 6C-E and S1). Furthermore, the effects of interfering with CDC5L and Caspase 3 were verified on HCC in vivo. It was found that, following the knockdown of histone deacetylase 6 (HDAC6), tumor volume gradually decreased and tumor size and tumor weight also decreased. Following the further knockdown of Caspase 3, tumor volume gradually increased and tumor size weight also increased (Fig. 7A-C). In addition, following the knockdown of HDAC6, LDH, IL-18 and IL-1β levels in the tissue supernatant increased. Following the further knockdown of Caspase 3, LDH, IL-18 and IL-1β levels decreased (Fig. 7D). Following the knockdown of HDAC6, CDC5L expressions in the tumor tissue decreased and Caspase 3, GSDME and GSDME-N expression increased. Following the further knockdown of Caspase 3, there was no significant change in CDC5L expression and Caspase 3, GSDME and GSDME-N expression decreased (Fig. 7E). These results indicated that CDC5L regulated pyroptosis in HCC in a Caspase 3-dependent manner.
CDC5L competitively binds to ELAVL1 to inhibit the binding of ELAVL1 and Caspase 3 mRNA to regulate the pyroptosis of HCC
The earlier results in the present study indicated that CDC5L downregulated Caspase 3 and reduced the stability of Caspase 3 mRNA. It was proposed in the present study that CDC5L might influence the stability of Caspase 3 mRNA through specific RBPs. Therefore, starting from CDC5L, a search for interacting proteins was performed and starting from Caspase 3 mRNA a search for interacting RBPs was performed; the RBPs were determined by finding the intersection of these two ways. First, the Venn diagram revealed the intersection between CDC5L binding proteins and Caspase 3 interacting RBPs, with a total of 22 (Fig. 8A). Bioinformatics analysis of the expression of these 22 RBPs in HCC was conducted to screen significant RBPs (Fig. 8B). Next, the expression of markedly altered RBP proteins KHDRBS1, NUDT21, HNRNPA2B1, RBMX, HNRNPC and ELAVL1 was validated in clinical tissues. As compared with the Normal group, KHDRBS1, NUDT21, HNRNPA2B1, RBMX, HNRNPC and ELAVL1 levels were elevated in the Tumor group. Among them, the expression of ELAVL1 was the most prominently increased, so it was selected for further analysis (Fig. 8C). Subsequently, ELAVL1 was knocked down and overexpressed. Compared with the si-NC group, ELAVL1 levels in the si-ELAVL1#1 and si-ELAVL1#2 groups were repressed, with the most significant decrease observed in the si-ELAVL1#2 group. As compared with the oe-NC group, ELAVL1 expression in the oe-ELAVL1 group was markedly elevated (Fig. 8D). The present study confirmed that si-ELAVL1 and oe-ELAVL1 were successfully transfected. Based on the UCSC Genome Browser, it was shown that ELAVL1 bound with Caspase 3 (Fig. 8E). RIP further confirmed the binding of ELAVL1 to Caspase 3 mRNA. Following the knockdown of ELAVL1, the binding of ELAVL1 to Caspase 3 mRNA was weakened. Following the overexpression of ELAVL1, the binding of ELAVL1 to Caspase 3 mRNA was enhanced (Fig. 8F). Furthermore, ELAVL1 knockdown inhibited the half-life of Caspase 3 mRNA following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8 and 10 h. ELAVL1 overexpression extended the half-life of Caspase 3 mRNA following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8 and 10 h (Fig. 8G). In addition, ELAVL1 knockdown promoted Caspase 3, LDH, IL-1β, IL-18, GSDME and GSDME-N levels. ELAVL1 overexpression repressed Caspase 3, LDH, IL-1β, IL-18, GSDME and GSDME-N levels (Fig. 9A-C). In addition, ELAVL1 knockdown promoted cell pyroptosis, while ELAVL1 overexpression inhibited cell pyroptosis (Fig. 10).
Furthermore, compared with the si-NC group, ELAVL1 expression in the si-CDC5L group was decreased. Compared with the oe-NC group, ELAVL1 expression in the oe-CDC5L group was markedly elevated (Fig. 11A). Co-IP verified the binding of CDC5L to ELAVL1 protein (Fig. 11B). In addition, following CDC5L knockdown, Caspase 3 expression increased. Following CDC5L overexpression, Caspase 3 expression decreased (Fig. 11C). RIP further verified the binding of ELAVL1 to Caspase 3 mRNA. Following CDC5L knockdown, the binding of ELAVL1 to Caspase 3 mRNA was enhanced. Following CDC5L overexpression, the binding of ELAVL1 to Caspase 3 mRNA was weakened (Fig. 11D). Next, the effects of interfering with CDC5L and overexpressing ELAVL1 on HCC pyroptosis was explored in vitro and in vivo. In vitro, CDC5L knockdown suppressed ELAVL1 expression. Upon further overexpression of ELAVL1, its expression increased (Fig. 11E). CDC5L knockdown promoted Caspase 3 expression. Upon further overexpression of ELAVL1, Caspase 3 expression decreased (Fig. 11F). RIP verified the binding stability of ELAVL1 protein with Caspase 3 mRNA. CDC5L knockdown enhanced the binding stability of ELAVL1 protein with Caspase 3 mRNA. Upon further overexpression of ELAVL1, it inhibited the binding stability of ELAVL1 protein with Caspase 3 mRNA (Fig. 12A). In addition, CDC5L knockdown promoted an increase in LDH, IL-1β, IL-18, GSDME and GSDME-N levels. Upon further overexpression of ELAVL1, it suppressed LDH, IL-1β, IL-18, GSDME and GSDME-N levels (Fig. 12B-C). Furthermore, CDC5L knockdown promoted cell pyroptosis. Upon further overexpression of ELAVL1, it inhibited cell pyroptosis (Fig. 12D). In addition, CDC5L knockdown extended the half-life of Caspase 3 mRNA following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8, 10 h. Overexpression of ELAVL1 inhibited the half-life of Caspase 3 mRNA following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8, 10 h (Fig. 12E). In vivo, it was found that following CDC5L knockdown, tumor volume gradually decreased and tumor size and weight were also reduced. Following further overexpression of ELAVL1, the tumor volume gradually increased and the tumor size and weight also increased (Fig. 13A-C). In addition, CDC5L knockdown promoted an increase in LDH, IL-1β, IL-18, CAPS3, GSDME and GSDME-N levels. Following further overexpression of ELAVL1, it suppressed CAPS3, LDH, IL-1β, IL-18, GSDME and GSDME-N levels (Fig. 13D - Forward). These results indicated that CDC5L competitively bound to ELAVL1 to inhibit the binding of ELAVL1 with Caspase 3 mRNA, thereby regulating pyroptosis in HCC.
CDC5L/ELAVL1 silencing regulates Caspase 3/GSDME to promote pyroptosis and inhibit tumor progression in HCC
Finally, the effect of CDC5L inhibitor CVT-313 and GSDME interference on HCC pyroptosis and tumor progression was investigated the in vitro and in vivo. RT-qPCR was performed on cells transfected with si-GSDME alone and the results showed that compared with the si-NC group, the expression of GSDME mRNA was markedly reduced in both the si-GSDME#1 and si-GSDME#2 groups. Among them, the si-GSDME#1 group exhibited the most pronounced reduction in GSDME mRNA expression and was used for subsequent experiments. This indicated that si-GSDME transfection successfully achieved knockdown of GSDME (Fig. 14A). At the cellular level, compared with the Control group, GSDME, GSDME-N and Caspase 3 levels were elevated, while those of CDC5L and ELAVL1 were reduced in the CVT-313 group. Following the additional knockdown of GSDME, GSDME and GSDME-N levels decreased, whereas Caspase 3, CDC5L and ELAVL1 levels remained largely unchanged (Fig. 14B-C). Cellular function experiments revealed that, as compared with the Control group, cell viability decreased and proliferation, migration and invasion capabilities were reduced in the CVT-313 group. Upon further knockdown of GSDME, cell viability increased and proliferation, migration and invasion capabilities increased (Figs. 14D-E and 15A). In addition, as compared with the Control group, LDH levels in the cell supernatant and pyroptosis increased in the CVT-313 group. Upon further knockdown of GSDME, LDH levels in the cell supernatant decreased and pyroptosis reduced (Fig. 15B-C). At the animal level, relative to the Control group, tumor volume decreased, tumor size reduced and tumor weight was alleviated in the CVT-313 group. Upon further knockdown of GSDME, tumor volume gradually increased and tumor size and weight also increased (Fig. 16A-C). In addition, as compared with the Control group, IL-1β, IL-18, LDH, Caspase 3, GSDME and GSDME-N levels increased, while CDC5L and ELAVL1 levels decreased in the CVT-313 group. upon further knockdown of GSDME, IL-1β, IL-18, LDH, GSDME and GSDME-N levels decreased, with no significant changes in CDC5L, ELAVL1 and Caspase 3 levels (Fig. 16D-E). These results indicated that CDC5L/ELAVL1 silencing regulated Caspase 3/GSDME to promote HCC pyroptosis and repress tumor progression.
CDC5L expression is elevated in HCC
First, CDC5L expression was analyzed in HCC based on the TCGA database. CDC5L exhibited high expression levels in the Tumor group compared with the Normal group (Fig. 1A). In addition, Kaplan-Meier survival analysis demonstrated that the overall survival time of patients with HCC in the high-CDC5L group was shorter, as compared with the low-CDC5L group (Fig. 1B). GSEA analysis showed that CDC5L was mainly enriched in Transcriptional Misregulation In Cancer [Normalized Enrichment Score (NES)=1.45; P<0.001; Fig. 1C]. Moreover, the functional pathways of highly expressed CDC5L involved the MAPK signaling pathway, PI3K-Akt signaling pathway, Wnt signaling pathway and others (Table SI). Next, western blot analysis further revealed CDC5L expression in clinical tissues. CDC5L expression was elevated in the HCC group compared with the paracancerous tissue group (Fig. 1D). In addition, CDC5L expression was further validated at the cellular level. CDC5L expression was elevated in human liver cancer cells (Huh7, SK-HEP-1 and MHCC-97H cells) compared with THLE-2 cells. Among them, CDC5L expression was most markedly elevated in SK-HEP-1 and MHCC-97H cells (Fig. 1E and F) and was therefore selected for subsequent experimental studies. The present results indicated that CDC5L expression was upregulated in HCC.
CDC5L regulates HCC pyroptosis
Next, CDC5L was knocked down. Compared with the si-NC group, CDC5L levels were reduced in the si-CDC5L-1 and si-CDC5L-2 groups. Among them, the si-CDC5L-2 group exhibited the most obvious reduction in CDC5L expression (Fig. 2A) and was therefore selected for subsequent experimental studies. Furthermore, CDC5L was overexpressed. For cells transfected with oe-CDC5L alone, RT-qPCR results showed a significant increase in CDC5L mRNA expression, indicating that oe-CDC5L transfection successfully achieved overexpression of CDC5L (Fig. 2B). CDC5L knockdown repressed cell viability, proliferation, migration and invasion, but CDC5L overexpression facilitated cell viability, proliferation, migration and invasion (Fig. 2C-E). In addition, CDC5L knockdown promoted LDH levels, PI positive rate, GSDME and GSDME-N levels and IL-18 and IL-1β levels. CDC5L overexpression suppressed LDH levels, PI positive rate, GSDME and GSDME-N levels and IL-18 and IL-1β levels (Fig. 3A-D). Moreover, the effects of low and high CDC5L expression was verified in HCC in vivo. It was found that, following CDC5L knockdown, the tumor volume was gradually reduced, along with reductions in tumor size and weight. Conversely, following CDC5L overexpression, the tumor volume gradually increased and both tumor size and weight grew larger (Fig. 4A-C). In addition, IL-18 and IL-1β levels were elevated following CDC5L knockdown. By contrast, these cytokine levels were diminished following CDC5L overexpression (Fig. 4D). CDC5L knockdown promoted GSDME and GSDME-N levels but repressed CDC5L levels. CDC5L overexpression suppressed GSDME and GSDME-N levels but elevated CDC5L levels (Fig. 4E). These results indicated that CDC5L regulated HCC pyroptosis.
The regulation of CDC5L on pyroptosis of HCC depends on the Caspase family
Based on GeneCards search results, Caspases 1-10 were seen to be involved in the progression of HCC. The Caspase family genes common to both the high and low expression groups of CDC5L were Caspases 1, 2, 3, 6, 7, 8, 9 and 10. According to GeneCards search results, among them, Caspases 1, 3, 6, 7, 8, 9 and 10 mediated the process of pyroptosis (Fig. 5A). The expression of Caspases 1, 3, 6, 7, 8, 9 and 10 was validated using RT-qPCR and western blotting. Caspase 3, a key protein involved in both pyroptosis and apoptosis, exerted tumor cytotoxicity via GSDME upon activation (34). Combining the results of mRNA and protein, it was observed CDC5L knockdown substantially elevated Caspase 3 expression, but CDC5L overexpression result in a markedly reduction in Caspase 3 expression (Fig. 5B). Therefore, Caspase 3 was selected for subsequent experiments. RIP was further used to detect the binding of CDC5L to Caspase 3 mRNA. The results showed that CDC5L did not bind to Caspase 3 mRNA (Fig. 5C). Next, Caspase 3 was used to interfere. For cells transfected with si-Caspase 3 alone, RT-qPCR results showed that compared with the si-NC group, the expression of Caspase 3 mRNA was markedly reduced in both the si-Caspase 3#1 and si-Caspase 3#2 groups. Among them, the si-Caspase 3#2 group exhibited the most pronounced reduction in Caspase 3 mRNA expression and was used for subsequent experiments. This indicated that si-Caspase 3 transfection successfully achieved knockdown of Caspase 3 (Fig. 5D). Compared with the si-NC group, si-CDC5L group exhibited a reduced the expression of CDC5L and increased the expression of Caspase 3. Upon the additional knockdown of Caspase 3, its expression decreased, while CDC5L expression remained largely unchanged (Fig. 5E). Cellular function experiments showed that, compared with si-NC group, cell viability, proliferation, migration and invasion capabilities in the si-CDC5L group were diminished. Following the further knockdown of Caspase 3, cell viability, proliferation, migration and invasion capabilities increased (Figs. 5F and 6A-B). In addition, compared with the si-NC group, LDH, IL-18 and IL-1β levels, PI positive rate and GSDME and GSDME-N protein levels in the si-CDC5L group increased. Following the further knockdown of Caspase 3, LDH, IL-18 and IL-1β levels decreased, PI positive rate decreased and GSDME and GSDME-N protein levels decreased (Figs. 6C-E and S1). Furthermore, the effects of interfering with CDC5L and Caspase 3 were verified on HCC in vivo. It was found that, following the knockdown of histone deacetylase 6 (HDAC6), tumor volume gradually decreased and tumor size and tumor weight also decreased. Following the further knockdown of Caspase 3, tumor volume gradually increased and tumor size weight also increased (Fig. 7A-C). In addition, following the knockdown of HDAC6, LDH, IL-18 and IL-1β levels in the tissue supernatant increased. Following the further knockdown of Caspase 3, LDH, IL-18 and IL-1β levels decreased (Fig. 7D). Following the knockdown of HDAC6, CDC5L expressions in the tumor tissue decreased and Caspase 3, GSDME and GSDME-N expression increased. Following the further knockdown of Caspase 3, there was no significant change in CDC5L expression and Caspase 3, GSDME and GSDME-N expression decreased (Fig. 7E). These results indicated that CDC5L regulated pyroptosis in HCC in a Caspase 3-dependent manner.
CDC5L competitively binds to ELAVL1 to inhibit the binding of ELAVL1 and Caspase 3 mRNA to regulate the pyroptosis of HCC
The earlier results in the present study indicated that CDC5L downregulated Caspase 3 and reduced the stability of Caspase 3 mRNA. It was proposed in the present study that CDC5L might influence the stability of Caspase 3 mRNA through specific RBPs. Therefore, starting from CDC5L, a search for interacting proteins was performed and starting from Caspase 3 mRNA a search for interacting RBPs was performed; the RBPs were determined by finding the intersection of these two ways. First, the Venn diagram revealed the intersection between CDC5L binding proteins and Caspase 3 interacting RBPs, with a total of 22 (Fig. 8A). Bioinformatics analysis of the expression of these 22 RBPs in HCC was conducted to screen significant RBPs (Fig. 8B). Next, the expression of markedly altered RBP proteins KHDRBS1, NUDT21, HNRNPA2B1, RBMX, HNRNPC and ELAVL1 was validated in clinical tissues. As compared with the Normal group, KHDRBS1, NUDT21, HNRNPA2B1, RBMX, HNRNPC and ELAVL1 levels were elevated in the Tumor group. Among them, the expression of ELAVL1 was the most prominently increased, so it was selected for further analysis (Fig. 8C). Subsequently, ELAVL1 was knocked down and overexpressed. Compared with the si-NC group, ELAVL1 levels in the si-ELAVL1#1 and si-ELAVL1#2 groups were repressed, with the most significant decrease observed in the si-ELAVL1#2 group. As compared with the oe-NC group, ELAVL1 expression in the oe-ELAVL1 group was markedly elevated (Fig. 8D). The present study confirmed that si-ELAVL1 and oe-ELAVL1 were successfully transfected. Based on the UCSC Genome Browser, it was shown that ELAVL1 bound with Caspase 3 (Fig. 8E). RIP further confirmed the binding of ELAVL1 to Caspase 3 mRNA. Following the knockdown of ELAVL1, the binding of ELAVL1 to Caspase 3 mRNA was weakened. Following the overexpression of ELAVL1, the binding of ELAVL1 to Caspase 3 mRNA was enhanced (Fig. 8F). Furthermore, ELAVL1 knockdown inhibited the half-life of Caspase 3 mRNA following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8 and 10 h. ELAVL1 overexpression extended the half-life of Caspase 3 mRNA following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8 and 10 h (Fig. 8G). In addition, ELAVL1 knockdown promoted Caspase 3, LDH, IL-1β, IL-18, GSDME and GSDME-N levels. ELAVL1 overexpression repressed Caspase 3, LDH, IL-1β, IL-18, GSDME and GSDME-N levels (Fig. 9A-C). In addition, ELAVL1 knockdown promoted cell pyroptosis, while ELAVL1 overexpression inhibited cell pyroptosis (Fig. 10).
Furthermore, compared with the si-NC group, ELAVL1 expression in the si-CDC5L group was decreased. Compared with the oe-NC group, ELAVL1 expression in the oe-CDC5L group was markedly elevated (Fig. 11A). Co-IP verified the binding of CDC5L to ELAVL1 protein (Fig. 11B). In addition, following CDC5L knockdown, Caspase 3 expression increased. Following CDC5L overexpression, Caspase 3 expression decreased (Fig. 11C). RIP further verified the binding of ELAVL1 to Caspase 3 mRNA. Following CDC5L knockdown, the binding of ELAVL1 to Caspase 3 mRNA was enhanced. Following CDC5L overexpression, the binding of ELAVL1 to Caspase 3 mRNA was weakened (Fig. 11D). Next, the effects of interfering with CDC5L and overexpressing ELAVL1 on HCC pyroptosis was explored in vitro and in vivo. In vitro, CDC5L knockdown suppressed ELAVL1 expression. Upon further overexpression of ELAVL1, its expression increased (Fig. 11E). CDC5L knockdown promoted Caspase 3 expression. Upon further overexpression of ELAVL1, Caspase 3 expression decreased (Fig. 11F). RIP verified the binding stability of ELAVL1 protein with Caspase 3 mRNA. CDC5L knockdown enhanced the binding stability of ELAVL1 protein with Caspase 3 mRNA. Upon further overexpression of ELAVL1, it inhibited the binding stability of ELAVL1 protein with Caspase 3 mRNA (Fig. 12A). In addition, CDC5L knockdown promoted an increase in LDH, IL-1β, IL-18, GSDME and GSDME-N levels. Upon further overexpression of ELAVL1, it suppressed LDH, IL-1β, IL-18, GSDME and GSDME-N levels (Fig. 12B-C). Furthermore, CDC5L knockdown promoted cell pyroptosis. Upon further overexpression of ELAVL1, it inhibited cell pyroptosis (Fig. 12D). In addition, CDC5L knockdown extended the half-life of Caspase 3 mRNA following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8, 10 h. Overexpression of ELAVL1 inhibited the half-life of Caspase 3 mRNA following treatment with 5 μg/ml Act D for 0, 2, 4, 6, 8, 10 h (Fig. 12E). In vivo, it was found that following CDC5L knockdown, tumor volume gradually decreased and tumor size and weight were also reduced. Following further overexpression of ELAVL1, the tumor volume gradually increased and the tumor size and weight also increased (Fig. 13A-C). In addition, CDC5L knockdown promoted an increase in LDH, IL-1β, IL-18, CAPS3, GSDME and GSDME-N levels. Following further overexpression of ELAVL1, it suppressed CAPS3, LDH, IL-1β, IL-18, GSDME and GSDME-N levels (Fig. 13D - Forward). These results indicated that CDC5L competitively bound to ELAVL1 to inhibit the binding of ELAVL1 with Caspase 3 mRNA, thereby regulating pyroptosis in HCC.
CDC5L/ELAVL1 silencing regulates Caspase 3/GSDME to promote pyroptosis and inhibit tumor progression in HCC
Finally, the effect of CDC5L inhibitor CVT-313 and GSDME interference on HCC pyroptosis and tumor progression was investigated the in vitro and in vivo. RT-qPCR was performed on cells transfected with si-GSDME alone and the results showed that compared with the si-NC group, the expression of GSDME mRNA was markedly reduced in both the si-GSDME#1 and si-GSDME#2 groups. Among them, the si-GSDME#1 group exhibited the most pronounced reduction in GSDME mRNA expression and was used for subsequent experiments. This indicated that si-GSDME transfection successfully achieved knockdown of GSDME (Fig. 14A). At the cellular level, compared with the Control group, GSDME, GSDME-N and Caspase 3 levels were elevated, while those of CDC5L and ELAVL1 were reduced in the CVT-313 group. Following the additional knockdown of GSDME, GSDME and GSDME-N levels decreased, whereas Caspase 3, CDC5L and ELAVL1 levels remained largely unchanged (Fig. 14B-C). Cellular function experiments revealed that, as compared with the Control group, cell viability decreased and proliferation, migration and invasion capabilities were reduced in the CVT-313 group. Upon further knockdown of GSDME, cell viability increased and proliferation, migration and invasion capabilities increased (Figs. 14D-E and 15A). In addition, as compared with the Control group, LDH levels in the cell supernatant and pyroptosis increased in the CVT-313 group. Upon further knockdown of GSDME, LDH levels in the cell supernatant decreased and pyroptosis reduced (Fig. 15B-C). At the animal level, relative to the Control group, tumor volume decreased, tumor size reduced and tumor weight was alleviated in the CVT-313 group. Upon further knockdown of GSDME, tumor volume gradually increased and tumor size and weight also increased (Fig. 16A-C). In addition, as compared with the Control group, IL-1β, IL-18, LDH, Caspase 3, GSDME and GSDME-N levels increased, while CDC5L and ELAVL1 levels decreased in the CVT-313 group. upon further knockdown of GSDME, IL-1β, IL-18, LDH, GSDME and GSDME-N levels decreased, with no significant changes in CDC5L, ELAVL1 and Caspase 3 levels (Fig. 16D-E). These results indicated that CDC5L/ELAVL1 silencing regulated Caspase 3/GSDME to promote HCC pyroptosis and repress tumor progression.
Discussion
Discussion
HCC is highly heterogeneous disease with distinct etiologies, which leads to different driver mutations that enhance a unique tumor immune microenvironment (35). Despite substantial advancements in cancer treatment, HCC, the most common form of liver cancer, remains a significant global public health challenge (36). In the present study, the role of CDC5L on HCC tumorigenesis and pyroptosis was explored both in vivo and in vitro. It was found that CDC5L bound to ELAVL1 to inhibit pyroptosis in HCC through the Caspase 3/GSDME signaling pathway. To the best of the authors' knowledge, this is the first study to report a CDC5L-induced regulation of ELAVL1 in HCC pyroptosis. It was also the first to demonstrate that CDC5L mediated the expression of Caspase 3 mRNA by binding to ELAVL1.
HCC is highly malignant and prone to metastasis, due to the heterogeneity and immunosuppressive nature of the tumor microenvironment (37). HCC development is a complex process involving the aberrant activation or inactivation of multiple signaling pathways (38). CDC5L is a novel human telomerase reverse transcriptase promoter binding protein (39). Mechanistic studies have shown that silencing PRP19 suppresses CDC5L expression in HCC cells by inhibiting CDC5L mRNA translation and promoting lysosome-mediated CDC5L degradation (9). CDC5L phosphorylation might contribute to HCC metastasis through the regulation of mRNA processing and RNA splicing (11). Furthermore, the high expression of methylated CDC5L-cg05671347 has been linked to improved overall survival in patients with HCC (40). In the present study, high CDC5L levels were found to be associated with poor HCC prognosis. Therefore, the mechanism of CDC5L in HCC was further explored.
Evidence has indicated that tumor cells undergoing regulated death might modulate immunogenicity in the tumor microenvironment to a certain degree, potentially rendering it more conducive to inhibiting cancer progression and metastasis (41). The induction of pyroptosis is considered an anticancer therapy, due to its ability to unleash an anticancer immune response (42). Upon detecting exogenous or endogenous signals, cells initiate processes such as the assembly of inflammatory vesicles, cleavage of GSDMs and release of pro-inflammatory cytokines, ultimately resulting in inflammatory cell death (43). Recent studies have highlighted that pyroptosis is a crucial factor in HCC development (44,45). In the present study, CDC5L knockdown repressed cell viability, proliferation, migration and invasion, at the cellular level but promoted pyroptosis. Also, at the animal level, CDC5L knockdown led to a gradual decrease in tumor volume and a reduction in tumor size and weight. CDC5L overexpression exerted the opposite effect. The results of the present study revealed that CDC5L acting in HCC could affect pyroptosis.
Pyroptosis and apoptosis are both forms of Caspase-mediated programmed cell death. Caspase 3 is an important protein in pyroptosis and apoptosis, controlling tumor cell toxicity when activated, while the expression of GSDME modulates this process (34). The Caspase 3/GSDME signaling pathway functions as a regulatory 'switch' that determines the balance between apoptosis and pyroptosis in cancer cells. When GSDME expression is high, Caspase 3 cleaves GSDME to induce pyroptosis; by contrast, when GSDME expression is low, Caspase 3 triggers apoptosis (22). Research has shown that cisplatin induced acute liver injury through triggering Caspase 3/GSDME-mediated cellular pyroptosis (46). Furthermore, Germacrone induced GSDME-dependent pyroptosis by activating the Caspase 3/GSDME pathway, at least in part by damaging mitochondria and enhancing ROS production, thus supporting the possibility of Germacrone as a candidate drug for the prevention and treatment of liver cancer (47). These studies suggest that the Caspase 3/GSDME pathway is highly significant in liver cancer, not only participating in the processes of apoptosis and pyroptosis but also potentially serving as a target for liver cancer treatment. In the present study, it was further discovered the regulation of HCC pyroptosis by CDC5L depends on the Caspase family. Therefore, the mechanisms of CDC5L and Caspase 3 in HCC pyroptosis will be further explored.
As an RNA-binding protein, the distribution and function of ELAVL1 within cells may be regulated by multiple signaling pathways (48). ELAVL1 functions as a crucial post-transcriptional regulator of specific RNAs in both normal and disease states, including cancer (49). ELAVL1 stabilizes target mRNAs involved in cellular de-differentiation, proliferation and survival (50). ELAVL1 is a gatekeeper of liver homeostasis and can prevent HCC (51). ELAVL1 has been reported to regulate hepatitis B virus replication and growth in HCC cells (52). In the nucleus, CCAT2 binds to ELAVL1 to promote HCC progression (53). In addition, cisplatin triggered acute kidney injury and pyroptosis in mice through exosomal miR-122/ELAVL1 regulatory pathway (54). However, the mechanism regarding the role of ELAVL1 and CDC5L in HCC pyroptosis is unclear. Research has shown that ELAVL1 regulates post-transcriptional gene expression in cancer cells and is subject to cleavage by stress-activated Caspase 3 (55). Qiu et al (56) confirmed that pre-mRNA processing factor 19 upregulated CDC5L expression, which bound to MAPK1, thereby promoting gastric cancer progression via the MAPK pathway-mediated homologous recombination. Additionally, IGF2BP1 acted as a post-transcriptional enhancer of CDC5L in an m6A-dependent manner to promote the proliferation of multiple myeloma cells with chromosome 1q gain (57). Jokoji et al (58) revealed that CDC5L promoted early chondrocyte differentiation and proliferation by modulating pre-mRNA splicing of SOX9, COL2A1 and WEE1. The KEGG analysis in the present study revealed that the functional pathways of highly expressed CDC5L involved the MAPK signaling pathway, PI3K-Akt signaling pathway, Wnt signaling pathway and others. In gastric cancer, high expression of CDC5L promoted homologous recombination by activating the MAPK signaling pathway, thereby driving the progression of gastric cancer (56). Research has shown that CDC5L mRNA was upregulated in the exosomes of osteosarcoma patients with poor chemotherapeutic responses. Moreover, bioinformatics analysis has found that miRNA patterns associated with poor chemotherapeutic responses were enriched in the PI3K-Akt signaling pathway (59). Therefore, high expression of CDC5L may affect the chemotherapeutic response in osteosarcoma by influencing the activity of the PI3K/Akt signaling pathway. Lan et al (60) reported that TRIP13 was primarily enriched in the PI3K-Akt-mTOR signaling pathway, suggesting that TRIP13 may promote the progression of breast cancer by influencing the activity of the PI3K/Akt signaling pathway. Since CDC5L is one of the hub genes highly associated with TRIP13, it can be inferred that CDC5L may indirectly influence the activity of the PI3K/Akt signaling pathway through its interaction with TRIP13. A study on lung adenocarcinoma demonstrated that CDC5L promoted the progression of lung adenocarcinoma by transcriptionally regulating WNT7B to activate the Wnt/β-catenin signaling pathway (61). Additionally, the ELAVL1/PI3K/NF-κB pathway regulated by lactoferrin was verified to participate in the protection of infantile intestinal immune barrier damage in the study by Li et al (62). These studies indicated that CDC5L and ELAVL1 play important roles in various cancers and related pathological processes through interactions with multiple key signaling pathways. CDC5L promotes cancer progression by activating the MAPK, PI3K-Akt and Wnt signaling pathways, while ELAVL1, as an RNA-binding protein, regulates the stability of specific mRNAs, affecting cell dedifferentiation, proliferation and survival. Although their roles in different cancers have been revealed in existing studies, the specific mechanisms of action of CDC5L and ELAVL1 in HCC pyroptosis still need further exploration. In the present study, at the cellular level, CDC5L was found to competitively bind to ELAVL1 to inhibit the binding of ELAVL1 with Caspase 3 mRNA, thereby regulating HCC pyroptosis. This discovery is significant for understanding the role of pyroptosis in tumor suppression. Finally, it was confirmed through cellular and animal experiments that silencing CDC5L/ELAVL1 regulated Caspase 3/GSDME to promote HCC pyroptosis and inhibit tumor progression. Therefore, targeting the CDC5L/ELAVL1 axis could pave the way for new therapeutic methods that increase the chemosensitivity of live cancer cells, thereby inhibiting tumor progression. Notably, the present study is the first to reveal the mechanism by which CDC5L interacts with ELAVL1 and regulates Caspase 3/GSDME signaling pathway in the pyroptosis of HCC. This finding not only provides a new potential therapeutic target for HCC, but also offers a new perspective for understanding the tumor microenvironment and immune regulation in HCC.
While the present study has made significant progress in exploring the mechanisms of CDC5L and ELAVL1 in HCC, there are still some limitations that need to be further improved in future research. First, the relatively small cohort size of the present study, which was limited by available resources and initial research design, may affect the universality and reliability of the results despite the significant statistical findings. Future research should expand the sample size to further validate the findings and reduce potential bias. Second, potential selection bias in TCGA analysis is also a concern. Although strict screening criteria were applied and data were validated multidimensionally, public database analyses are generally subject to factors such as sample sources and data quality and potential bias cannot be completely ruled out. Therefore, future research needs to combine more independent datasets for validation to improve the reliability and universality of the results. In addition, the present study relied on only two HCC cell lines, which may limit the generality of the results. Although these two cell lines are widely used and representative in HCC research, significant biological differences may exist between different cell lines. To more comprehensively evaluate the mechanisms of CDC5L and ELAVL1, future research plans to introduce more HCC cell lines and explore the differences and commonalities between them. Finally, the lack of in situ or immunologically active in vivo models in the present study somewhat limits our comprehensive understanding of the HCC pathological process. In vitro experiments and animal models have limitations in simulating human diseases. For an improved simulation of the HCC pathological process, future research plans to develop in situ HCC models and explore immunologically active models to more comprehensively assess the mechanisms of CDC5L and ELAVL1.
In conclusion, in the present study, a preliminary investigation into the mechanism of CDC5L in HCC was conducted and its potential mode was found to be associated with its interaction with ELAVL1 and pyroptosis. These findings suggested a new way of considering the treatment of HCC. Furthermore, gaining a deeper understanding of the involvement of pyroptosis in HCC may provide a basis for exploring and developing new therapeutic approaches to combat HCC.
HCC is highly heterogeneous disease with distinct etiologies, which leads to different driver mutations that enhance a unique tumor immune microenvironment (35). Despite substantial advancements in cancer treatment, HCC, the most common form of liver cancer, remains a significant global public health challenge (36). In the present study, the role of CDC5L on HCC tumorigenesis and pyroptosis was explored both in vivo and in vitro. It was found that CDC5L bound to ELAVL1 to inhibit pyroptosis in HCC through the Caspase 3/GSDME signaling pathway. To the best of the authors' knowledge, this is the first study to report a CDC5L-induced regulation of ELAVL1 in HCC pyroptosis. It was also the first to demonstrate that CDC5L mediated the expression of Caspase 3 mRNA by binding to ELAVL1.
HCC is highly malignant and prone to metastasis, due to the heterogeneity and immunosuppressive nature of the tumor microenvironment (37). HCC development is a complex process involving the aberrant activation or inactivation of multiple signaling pathways (38). CDC5L is a novel human telomerase reverse transcriptase promoter binding protein (39). Mechanistic studies have shown that silencing PRP19 suppresses CDC5L expression in HCC cells by inhibiting CDC5L mRNA translation and promoting lysosome-mediated CDC5L degradation (9). CDC5L phosphorylation might contribute to HCC metastasis through the regulation of mRNA processing and RNA splicing (11). Furthermore, the high expression of methylated CDC5L-cg05671347 has been linked to improved overall survival in patients with HCC (40). In the present study, high CDC5L levels were found to be associated with poor HCC prognosis. Therefore, the mechanism of CDC5L in HCC was further explored.
Evidence has indicated that tumor cells undergoing regulated death might modulate immunogenicity in the tumor microenvironment to a certain degree, potentially rendering it more conducive to inhibiting cancer progression and metastasis (41). The induction of pyroptosis is considered an anticancer therapy, due to its ability to unleash an anticancer immune response (42). Upon detecting exogenous or endogenous signals, cells initiate processes such as the assembly of inflammatory vesicles, cleavage of GSDMs and release of pro-inflammatory cytokines, ultimately resulting in inflammatory cell death (43). Recent studies have highlighted that pyroptosis is a crucial factor in HCC development (44,45). In the present study, CDC5L knockdown repressed cell viability, proliferation, migration and invasion, at the cellular level but promoted pyroptosis. Also, at the animal level, CDC5L knockdown led to a gradual decrease in tumor volume and a reduction in tumor size and weight. CDC5L overexpression exerted the opposite effect. The results of the present study revealed that CDC5L acting in HCC could affect pyroptosis.
Pyroptosis and apoptosis are both forms of Caspase-mediated programmed cell death. Caspase 3 is an important protein in pyroptosis and apoptosis, controlling tumor cell toxicity when activated, while the expression of GSDME modulates this process (34). The Caspase 3/GSDME signaling pathway functions as a regulatory 'switch' that determines the balance between apoptosis and pyroptosis in cancer cells. When GSDME expression is high, Caspase 3 cleaves GSDME to induce pyroptosis; by contrast, when GSDME expression is low, Caspase 3 triggers apoptosis (22). Research has shown that cisplatin induced acute liver injury through triggering Caspase 3/GSDME-mediated cellular pyroptosis (46). Furthermore, Germacrone induced GSDME-dependent pyroptosis by activating the Caspase 3/GSDME pathway, at least in part by damaging mitochondria and enhancing ROS production, thus supporting the possibility of Germacrone as a candidate drug for the prevention and treatment of liver cancer (47). These studies suggest that the Caspase 3/GSDME pathway is highly significant in liver cancer, not only participating in the processes of apoptosis and pyroptosis but also potentially serving as a target for liver cancer treatment. In the present study, it was further discovered the regulation of HCC pyroptosis by CDC5L depends on the Caspase family. Therefore, the mechanisms of CDC5L and Caspase 3 in HCC pyroptosis will be further explored.
As an RNA-binding protein, the distribution and function of ELAVL1 within cells may be regulated by multiple signaling pathways (48). ELAVL1 functions as a crucial post-transcriptional regulator of specific RNAs in both normal and disease states, including cancer (49). ELAVL1 stabilizes target mRNAs involved in cellular de-differentiation, proliferation and survival (50). ELAVL1 is a gatekeeper of liver homeostasis and can prevent HCC (51). ELAVL1 has been reported to regulate hepatitis B virus replication and growth in HCC cells (52). In the nucleus, CCAT2 binds to ELAVL1 to promote HCC progression (53). In addition, cisplatin triggered acute kidney injury and pyroptosis in mice through exosomal miR-122/ELAVL1 regulatory pathway (54). However, the mechanism regarding the role of ELAVL1 and CDC5L in HCC pyroptosis is unclear. Research has shown that ELAVL1 regulates post-transcriptional gene expression in cancer cells and is subject to cleavage by stress-activated Caspase 3 (55). Qiu et al (56) confirmed that pre-mRNA processing factor 19 upregulated CDC5L expression, which bound to MAPK1, thereby promoting gastric cancer progression via the MAPK pathway-mediated homologous recombination. Additionally, IGF2BP1 acted as a post-transcriptional enhancer of CDC5L in an m6A-dependent manner to promote the proliferation of multiple myeloma cells with chromosome 1q gain (57). Jokoji et al (58) revealed that CDC5L promoted early chondrocyte differentiation and proliferation by modulating pre-mRNA splicing of SOX9, COL2A1 and WEE1. The KEGG analysis in the present study revealed that the functional pathways of highly expressed CDC5L involved the MAPK signaling pathway, PI3K-Akt signaling pathway, Wnt signaling pathway and others. In gastric cancer, high expression of CDC5L promoted homologous recombination by activating the MAPK signaling pathway, thereby driving the progression of gastric cancer (56). Research has shown that CDC5L mRNA was upregulated in the exosomes of osteosarcoma patients with poor chemotherapeutic responses. Moreover, bioinformatics analysis has found that miRNA patterns associated with poor chemotherapeutic responses were enriched in the PI3K-Akt signaling pathway (59). Therefore, high expression of CDC5L may affect the chemotherapeutic response in osteosarcoma by influencing the activity of the PI3K/Akt signaling pathway. Lan et al (60) reported that TRIP13 was primarily enriched in the PI3K-Akt-mTOR signaling pathway, suggesting that TRIP13 may promote the progression of breast cancer by influencing the activity of the PI3K/Akt signaling pathway. Since CDC5L is one of the hub genes highly associated with TRIP13, it can be inferred that CDC5L may indirectly influence the activity of the PI3K/Akt signaling pathway through its interaction with TRIP13. A study on lung adenocarcinoma demonstrated that CDC5L promoted the progression of lung adenocarcinoma by transcriptionally regulating WNT7B to activate the Wnt/β-catenin signaling pathway (61). Additionally, the ELAVL1/PI3K/NF-κB pathway regulated by lactoferrin was verified to participate in the protection of infantile intestinal immune barrier damage in the study by Li et al (62). These studies indicated that CDC5L and ELAVL1 play important roles in various cancers and related pathological processes through interactions with multiple key signaling pathways. CDC5L promotes cancer progression by activating the MAPK, PI3K-Akt and Wnt signaling pathways, while ELAVL1, as an RNA-binding protein, regulates the stability of specific mRNAs, affecting cell dedifferentiation, proliferation and survival. Although their roles in different cancers have been revealed in existing studies, the specific mechanisms of action of CDC5L and ELAVL1 in HCC pyroptosis still need further exploration. In the present study, at the cellular level, CDC5L was found to competitively bind to ELAVL1 to inhibit the binding of ELAVL1 with Caspase 3 mRNA, thereby regulating HCC pyroptosis. This discovery is significant for understanding the role of pyroptosis in tumor suppression. Finally, it was confirmed through cellular and animal experiments that silencing CDC5L/ELAVL1 regulated Caspase 3/GSDME to promote HCC pyroptosis and inhibit tumor progression. Therefore, targeting the CDC5L/ELAVL1 axis could pave the way for new therapeutic methods that increase the chemosensitivity of live cancer cells, thereby inhibiting tumor progression. Notably, the present study is the first to reveal the mechanism by which CDC5L interacts with ELAVL1 and regulates Caspase 3/GSDME signaling pathway in the pyroptosis of HCC. This finding not only provides a new potential therapeutic target for HCC, but also offers a new perspective for understanding the tumor microenvironment and immune regulation in HCC.
While the present study has made significant progress in exploring the mechanisms of CDC5L and ELAVL1 in HCC, there are still some limitations that need to be further improved in future research. First, the relatively small cohort size of the present study, which was limited by available resources and initial research design, may affect the universality and reliability of the results despite the significant statistical findings. Future research should expand the sample size to further validate the findings and reduce potential bias. Second, potential selection bias in TCGA analysis is also a concern. Although strict screening criteria were applied and data were validated multidimensionally, public database analyses are generally subject to factors such as sample sources and data quality and potential bias cannot be completely ruled out. Therefore, future research needs to combine more independent datasets for validation to improve the reliability and universality of the results. In addition, the present study relied on only two HCC cell lines, which may limit the generality of the results. Although these two cell lines are widely used and representative in HCC research, significant biological differences may exist between different cell lines. To more comprehensively evaluate the mechanisms of CDC5L and ELAVL1, future research plans to introduce more HCC cell lines and explore the differences and commonalities between them. Finally, the lack of in situ or immunologically active in vivo models in the present study somewhat limits our comprehensive understanding of the HCC pathological process. In vitro experiments and animal models have limitations in simulating human diseases. For an improved simulation of the HCC pathological process, future research plans to develop in situ HCC models and explore immunologically active models to more comprehensively assess the mechanisms of CDC5L and ELAVL1.
In conclusion, in the present study, a preliminary investigation into the mechanism of CDC5L in HCC was conducted and its potential mode was found to be associated with its interaction with ELAVL1 and pyroptosis. These findings suggested a new way of considering the treatment of HCC. Furthermore, gaining a deeper understanding of the involvement of pyroptosis in HCC may provide a basis for exploring and developing new therapeutic approaches to combat HCC.
Supplementary Data
Supplementary Data
출처: PubMed Central (JATS). 라이선스는 원 publisher 정책을 따릅니다 — 인용 시 원문을 표기해 주세요.
🏷️ 같은 키워드 · 무료전문 — 이 논문 MeSH/keyword 기반
- Key Considerations for Targeting in Pancreatic Cancer: Potential Impact on the Treatment Paradigm.
- Raman Spectroscopic Signatures of Hepatic Carcinoma: Progress and Future Prospect.
- The role of disulfidptosis-driven tumor microenvironment remodeling in pancreatic cancer progression.
- Effective use of PROs for survival prediction: Transformer-based modelling in NSCLC patients.
- Combining network pharmacology and experimental validation to study the action and mechanism of brusatol against lung adenocarcinoma.
- Acquired L858R mutation following -TKI resistance in lung adenocarcinoma: a case report.