본문으로 건너뛰기
← 뒤로

miR-139-5p suppresses hepatocellular carcinoma progression by targeting SMOX to inhibit AKT-mTOR pathway and epithelial-mesenchymal transition.

1/5 보강
Scientific reports 📖 저널 OA 98.9% 2021: 24/24 OA 2022: 32/32 OA 2023: 45/45 OA 2024: 140/140 OA 2025: 938/938 OA 2026: 743/767 OA 2021~2026 2025 Vol.16(1) p. 3602
Retraction 확인
출처

Pei W, Li K, Bai Y, Ren L, Mo A, Mei J

📝 환자 설명용 한 줄

This study investigates the tumor-suppressive role of miR-139-5p in hepatocellular carcinoma (HCC) and its molecular mechanism of regulating the AKT-mTOR signaling pathway through targeting spermidine

이 논문을 인용하기

↓ .bib ↓ .ris
APA Pei W, Li K, et al. (2025). miR-139-5p suppresses hepatocellular carcinoma progression by targeting SMOX to inhibit AKT-mTOR pathway and epithelial-mesenchymal transition.. Scientific reports, 16(1), 3602. https://doi.org/10.1038/s41598-025-33615-1
MLA Pei W, et al.. "miR-139-5p suppresses hepatocellular carcinoma progression by targeting SMOX to inhibit AKT-mTOR pathway and epithelial-mesenchymal transition.." Scientific reports, vol. 16, no. 1, 2025, pp. 3602.
PMID 41444797 ↗

Abstract

This study investigates the tumor-suppressive role of miR-139-5p in hepatocellular carcinoma (HCC) and its molecular mechanism of regulating the AKT-mTOR signaling pathway through targeting spermidine oxidase (SMOX). Analysis of TCGA and UALCAN databases revealed significantly lower expression of miR-139-5p in HCC tissues and cell lines, which correlated with poor clinical prognosis. Further experiments demonstrated that miR-139-5p overexpression notably inhibited HCC cell proliferation, migration, and invasion. Additionally, dual-luciferase assays confirmed that SMOX is a target of miR-139-5p. SMOX was found to be overexpressed in HCC tissues and closely associated with adverse prognosis. The study also revealed that SMOX promotes HCC progression by activating the AKT-mTOR signaling pathway and epithelial-mesenchymal transition (EMT). Overexpression of SMOX significantly increased the phosphorylation levels of AKT, mTOR, and their downstream effectors, while upregulating EMT markers such as N-cadherin, vimentin, and Snail, and downregulating the epithelial marker E-cadherin. Rescue experiments demonstrated that miR-139-5p suppressed SMOX expression, thereby inhibiting the activation of the AKT-mTOR pathway and EMT, ultimately reducing HCC cell proliferation and invasion. This study, for the first time, elucidates the mechanism by which miR-139-5p suppresses HCC progression through targeting SMOX to inhibit the AKT-mTOR pathway and EMT. These findings suggest that both miR-139-5p and SMOX could serve as potential therapeutic targets for HCC treatment.

🏷️ 키워드 / MeSH 📖 같은 키워드 OA만

… 외 1개

같은 제1저자의 인용 많은 논문 (2)

📖 전문 본문 읽기 PMC JATS · ~58 KB · 영문

Introduction

Introduction
Hepatocellular carcinoma (HCC) is one of the most prevalent malignant tumors worldwide, accounting for 85%-90% of all primary liver cancers. The high incidence and mortality rates of HCC present a significant challenge for global cancer research1. The development of HCC is often closely associated with chronic liver diseases such as viral hepatitis (HBV and HCV)2, alcoholic liver disease3, and non-alcoholic fatty liver disease (NAFLD)4. Despite significant advancements in molecular targeted therapy and immunotherapy in recent years, many HCC patients, particularly those with advanced stages, still face limited treatment options and poor prognosis. This is attributed to the tumor’s high heterogeneity, complex tumor microenvironment, and resistance to existing therapies5.
In the study of HCC’s molecular mechanisms, microRNAs (miRNAs) have garnered significant attention as crucial regulators of gene expression6. miRNAs regulate various biological processes such as cell proliferation, differentiation, and apoptosis by binding to the 3’ untranslated regions of mRNAs, inhibiting translation or promoting degradation7,8. Increasing evidence suggests that miRNAs play essential roles in the initiation, progression, and treatment of HCC9. In particular, miR-139-5p has shown potential as a tumor suppressor in multiple cancer types. For example, miR-139-5p inhibits tumor growth in colorectal cancer by targeting NOTCH110 and negatively regulates PMP22 through the NF-κB signaling pathway in gastric cancer to suppress cell proliferation11. Additionally, miR-139-5p promotes prostate cancer progression by regulating SOX512. However, the specific role and molecular mechanisms of miR-139-5p in HCC remain unclear, and studies on this topic are relatively limited.
Spermidine oxidase (SMOX) is a key enzyme in polyamine metabolism, responsible for catalyzing the oxidation of spermidine13. Polyamine metabolism is essential for maintaining critical cellular processes, including proliferation, DNA stability, and signal transduction14. Disruption of polyamine metabolism is closely linked to tumor initiation and progression15. Through its oxidation reaction, SMOX generates reactive oxygen species (ROS), which, in moderation, serve as signaling molecules to regulate various cellular activities. However, excessive ROS accumulation can lead to oxidative stress and DNA damage, further promoting tumorigenesis16. Numerous studies have demonstrated that SMOX is overexpressed in several cancers, and its elevated levels are associated with increased tumor cell proliferation, invasion, and poor prognosis. For example, high SMOX expression has been observed in esophagus17, and lung cancers18, where it correlates with more aggressive tumor behavior and greater resistance to chemotherapy. Despite these findings, the specific role of SMOX in HCC remains poorly understood. Further research is needed to clarify the precise function of SMOX in liver cancer and to assess its potential as a therapeutic target.
The AKT-mTOR signaling pathway plays a crucial role in regulating cell growth, proliferation, metabolism, and survival19. Its abnormal activation is commonly observed in various cancers, including HCC20,21. This pathway is activated by PI3K, which in turn activates AKT, leading to the activation of mTORC1. This promotes protein synthesis, inhibits autophagy, enhances cell survival and proliferation, and increases tumor cell invasiveness and metastatic potential22. Additionally, it is closely associated with treatment resistance and poor prognosis. Dysregulation of the AKT-mTOR pathway often accelerates cancer progression, making it an important target for cancer therapy23,24. While mTOR and AKT inhibitors have shown some efficacy in clinical trials, resistance remains a significant challenge25,26. This study aims to investigate the relationship between miR-139-5p, SMOX, and the AKT-mTOR signaling pathway, uncovering the tumor-suppressive role of miR-139-5p in HCC and offering potential new therapeutic targets for HCC treatment.
In conclusion, this study hypothesizes that miR-139-5p suppresses HCC cell proliferation and invasion by targeting SMOX to regulate the AKT-mTOR signaling pathway. The goal of this research is to validate this hypothesis through in vitro and in vivo experiments and further investigate the potential therapeutic role of miR-139-5p in HCC. It is hoped that this study will provide new insights into the molecular mechanisms of HCC and lay a theoretical foundation for future therapeutic strategies for HCC.

Materials and methods

Materials and methods

Cell lines and culture conditions
In this study, multiple human hepatocellular carcinoma (HCC) cell lines were used, including HepG2, Huh7, Li-7, SNU398, Hep3B, and Hcclm3, which were purchased from the Chinese Academy of Sciences Cell Bank. The normal liver cell line THLE-2 was used as a control. All cells were cultured in DMEM or RPMI 1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The cells were maintained at 37 °C in a 5% CO₂ incubator, with regular media changes to ensure healthy growth.

HCC tissue samples
HCC tissue samples were obtained from the Department of Pathology at the First Affiliated Hospital of Wannan Medical College. A total of 5 pairs of HCC tumor tissues and adjacent normal tissues were collected. All samples were fixed in formalin and embedded in paraffin for immunohistochemical analysis. Informed consent was obtained from all patients, and the study was approved by the Ethics Committee of Wannan Medical College (Approval number: 202095), adhering to the principles of the Declaration of Helsinki.

Transfection experiments
Hep3B and Huh7 cells were transfected with synthetic miR-139-5p mimic and inhibitor (Thermo Fisher, USA) to evaluate the effects of miR-139-5p under different experimental conditions. To study the function of SMOX, SMOX-specific shRNA (RiboBio, China) was used for SMOX knockdown, while SMOX overexpression plasmids (GeneCopoeia, USA) were used for SMOX overexpression experiments. Cells were seeded at 50–70% confluence, and Lipofectamine 3000 (Invitrogen, USA) was used for transfection. After 48 h, cells were harvested for subsequent mRNA, protein expression, and functional assays. The sequence for sh-SMOX was CGGCACGATAAACCAGTCAAT.

RNA extraction and RT-qPCR
Total RNA was extracted from transfected HCC cells and paraffin-embedded HCC tissues using TRIzol reagent (Invitrogen, USA), following the manufacturer’s instructions. For paraffin tissue, the RNA extraction was preceded by dewaxing with xylene. RNA concentration and purity were assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA). After extraction, cDNA was synthesized using a reverse transcription kit (Takara, Japan). Quantitative PCR (qPCR) was performed with SYBR Green PCR Master Mix (Thermo Scientific, USA) on a StepOnePlus™ real-time PCR system. Relative gene expression levels were calculated using the 2^−ΔΔCt method, with U6 as the miRNA reference and β-actin as the mRNA reference. The primers used are as follows:
miR-139-5p Forward: 5’-CGCGTCTACAGTGCACGTGTC-3’,
miR-139-5p Reverse: 5’- AGTGCAGGGTCCGAGGTATT − 3’,
SMOX Forward: 5’-CGGATGACCCTCTCAGTCG-3’,
SMOX Reverse: 5’-GCGTGTCCAAGTTTCACACT-3’,
β-actin Forward: 5’-CATGTACGTTGCTATCCAGGC-3’,
β-actin Reverse: 5’-CTCCTTAATGTCACGCACGAT-3’.

Western blot (WB) analysis
Proteins were extracted from HCC cells using RIPA lysis buffer (Beyotime, China). Protein concentrations were measured using a BCA protein assay kit (Thermo Scientific, USA). For each sample, 30–50 µg of protein was separated by SDS-PAGE and transferred to PVDF membranes (Millipore, USA). Membranes were blocked with 5% non-fat milk for 1 h and then incubated overnight at 4 °C with primary antibodies: anti-SMOX (Abclonal, China, #A11677, 1:1000), anti-AKT (Proteintech, USA, #10176-2-AP, 1:1000), anti-p-AKT (Ser473) (Proteintech, USA, #28731-1-AP, 1:1000), anti-mTOR (Cell Signaling Technology, USA, #2972S, 1:1000), anti-p-mTOR (Ser2448) (Cell Signaling Technology, USA, #5536S, 1:1000), anti-p70S6K (Cell Signaling Technology, USA, #9202S, 1:1000), anti-p-P70S6K (Thr389) (Cell Signaling Technology, USA, #9234S, 1:1000), anti-N-cadherin (Cell Signaling Technology, USA, #13116S, 1:1000), anti-E-cadherin (Cell Signaling Technology, USA, #14472S, 1:1000), anti-vimentin (Cell Signaling Technology, USA, #5741S, 1:1000), anti-Snail (Cell Signaling Technology, USA, #3879S, 1:1000). The membrane was then incubated with HRP-conjugated secondary antibodies for 1 h at room temperature, and protein bands were detected using enhanced chemiluminescence (ECL) reagents (Millipore, USA). The intensity of protein bands was quantified using ImageJ software. In this study, due to the large number of proteins involved, we applied antibodies to the membrane after cutting. Before cutting, we took images of the entire membrane and labeled each protein to verify its correct position. Additionally, molecular weight markers were included for each protein to confirm the correct positioning. All experiments were repeated three times to ensure the reliability of the results.

CCK-8 cell proliferation assay
Cell proliferation was assessed using a CCK-8 kit (Dojindo, Japan). Transfected Hep3B and Huh7 cells were seeded in 96-well plates at a density of 5000 cells per well. After 24 h of transfection, 10 µL of CCK-8 reagent was added, and cells were incubated for 2 h. The absorbance at 450 nm was measured using a microplate reader. The experiment was repeated three times, and the average value was taken.

Cell migration assay
Transfected Hep3B and Huh7 cells were seeded in 6-well plates. Once cells reached confluence, a scratch wound was made using a sterile pipette tip, and floating cells were removed. Serum-free medium was added, and cells were incubated for 48 h. The wound healing was observed and captured using a microscope, and the healing area was calculated. The experiment was repeated three times.

Cell invasion assay
Invasion assays were performed using Transwell chambers with an 8 μm pore size (Corning, USA). Approximately 1 × 10⁵ cells were resuspended in 200 µL serum-free medium and added to the upper chamber, while 600 µL of medium containing 10% FBS was added to the lower chamber. After 24 h of incubation, non-migrated cells were removed, and the invading cells were fixed and stained. The number of invading cells was counted under a microscope. The experiment was repeated three times.

Animal experiments
Four-week-old male nude mice (BALB/c, purchased from Zhejiang Ziyuan Experimental Animal Technology Co., Ltd.) with an average body weight of 20–25 g were maintained in a standard sterile environment at 20–26 °C with a 12-hour light/dark cycle and free access to water and food. All animal experiments were approved by the Ethics Committee of Wannan Medical College (Approval number: WNMC-AWE-2024421). All procedures were performed in accordance with the institutional ethical guidelines and the ARRIVE guidelines (https://arriveguidelines.org). Sample size was determined based on preliminary experiments and power analysis to ensure that three mice per group would provide sufficient statistical power (80%) to detect differences in tumor growth at a significance level of 0.05. Mice were randomly assigned to the experimental and control groups using a computer-generated random number list. Tumor measurements and subsequent analyses were conducted by an investigator blinded to the group assignments to reduce bias.
The experimental group was subcutaneously injected with 1 × 10⁶ Huh7 cells stably overexpressing miR-139-5p into the left axilla, while the control group received Huh-7 cells transfected with an empty vector. Tumor size was measured daily using calipers, recording the longest (L) and shortest (W) diameters, and tumor volume was calculated using the formula V = 0.5 × L × W² (in cm³). Tumor burden was closely monitored, and tumor volume did not exceed 2000 mm³ in any animal.At the end of the experiment, all mice were euthanized by cervical dislocation under isoflurane anesthesia to ensure humane treatment. Tumors were excised and processed for further molecular and histological analyses. Animal health was monitored daily throughout the study, and no animals exhibited signs of distress beyond acceptable limits.

Immunohistochemical (IHC) analysis
Paraffin-embedded sections of HCC tissues, adjacent normal tissues, and xenograft tumor tissues from nude mice were dewaxed and rehydrated, followed by immunohistochemical staining. After antigen retrieval and blocking, tissue sections were incubated overnight at 4 °C with the following primary antibodies: anti-Ki67 (ABclonal, China, #A20018, 1:200), anti-SMOX (ABclonal, China, #A11677, 1:200), anti-p-AKT (Ser473) (Epizyme Biotech, China, #R011470, 1:200), anti-p-mTOR (Ser2448) (Epizyme Biotech, China, #R010732, 1:200), anti-p-P70S6K (Proteintech, USA, #28735-1-AP, 1:200), anti-N-cadherin (Servicebio, China, #GB11135, 1:200), anti-E-cadherin (Servicebio, China, #GB12083, 1:200), anti-Vimentin (Servicebio, China, #GB11192, 1:200), and anti-Snail (Epizyme Biotech, China, #R013727, 1:200).The following day, sections were incubated with HRP-conjugated secondary antibodies, developed with DAB chromogen, and counterstained with hematoxylin. Stained sections were examined and photographed under a light microscope.

Dual-luciferase reporter assay
The 3’ untranslated region (UTR) of SMOX containing the miR-139-5p binding site was cloned into a pmirGLO luciferase reporter vector (Promega, USA). HEK-293T cells were co-transfected with the reporter vector and miR-139-5p mimic. After 48 h, luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, USA) according to the manufacturer’s instructions. The relative luciferase activity was normalized to the Renilla luciferase activity.

Bioinformatics analysis
RNA-seq data generated by STAR aligner from the TCGA-ALL (Pan-cancer) project were downloaded and extracted in TPM format for adjacent normal and tumor tissue samples. Differential expression between normal and tumor tissues was analyzed using the Wilcoxon signed-rank test. Data that did not meet statistical requirements were excluded from the analysis. Data for this project can be accessed via https://portal.gdc.cancer.gov. Additionally, miRNA-seq data from the TCGA-LIHC (Hepatocellular Carcinoma, HCC) project, processed by BCGSC, were downloaded in RPM format and visualized using the ggplot2 package. Spearman’s rank correlation coefficient was used to examine associations between data variables. The UALCAN database (http://ualcan.path.uab.edu) was utilized to analyze the top 10 lowest-expressed miRNAs in HCC.

Statistical data analysis
All data are presented as mean ± standard deviation (Mean ± SD). Data analysis was conducted using GraphPad Prism 8 software. Between-group comparisons were made using the independent sample t-test or one-way analysis of variance (ANOVA), with a significance level set at P < 0.05. For bioinformatics data, the Wilcoxon signed-rank test and Spearman correlation analysis were performed using the R language stats and car packages.

Results

Results

Low expression of miR-139-5p in HCC tissues and cell lines Is associated with poor prognosis
miRNAs typically regulate gene expression by binding to target genes, often resulting in low expression in tumors, leading to the loss of normal control over oncogenes. In our analysis using the UALCAN database, we found that miR-139-5p was among the top 10 least expressed miRNAs in HCC cells (Fig. 1A). To further investigate the role of miR-139, we examined its expression in HCC tissues using data from the TCGA database, which revealed a significant reduction in miR-139 expression compared to paired normal tissues (Fig. 1B and C). Pan-cancer analysis also showed low expression of miR-139 across several cancer types, including breast cancer, colon cancer, and lung cancer (Fig. 1D). Moreover, survival analysis demonstrated that low miR-139 expression was associated with poorer overall survival (OS) in HCC patients (Fig. 1E). RT-qPCR validation confirmed that miR-139-5p expression was significantly lower in HCC tissues (Fig. 1F) and cell lines (Hep3B and Huh7, Fig. 1G) compared to the normal liver cell line, THLE-2. Particularly, the expression of miR-139-5p was notably low in Hep3B and Huh7 cells. Additionally, clinical feature analysis revealed that low miR-139-5p expression correlated significantly with poor prognostic factors, such as pathologic T stage, pathologic stage, and tumor status (Table 1). These results suggest that miR-139-5p may play a crucial tumor-suppressive role in HCC progression.

miR-139-5p inhibits HCC cell proliferation in vitro and in vivo
To explore the functional impact of miR-139-5p on HCC cells, we transfected Hep3B and Huh7 cells with a miR-139-5p mimic and confirmed overexpression efficiency via RT-qPCR (Fig. 2A). CCK-8 assays showed that miR-139-5p overexpression significantly reduced the proliferation of both Hep3B and Huh7 cells (Fig. 2B). In vivo, nude mouse xenograft experiments demonstrated that tumors formed from Huh-7 cells stably infected with the lentiviral miR-139-5p expression vector were significantly smaller and lighter than those in the control group (Figs. 2C–E), with reduced Ki-67-positive cell counts (Fig. 2F). The expression of miR-139-5p in tumor tissues of nude mice was detected by RT-qPCR (Figure SA).These findings indicate that miR-139-5p exerts a significant inhibitory effect on HCC cell proliferation.

miR-139-5p inhibits HCC cell migration and invasion
Wound healing assays and Transwell invasion assays revealed that after transfection with the miR-139-5p mimic, the migratory capacity of Hep3B and Huh7 cells was significantly reduced, as evidenced by slower wound closure (Fig. 2G). Transwell assays further confirmed that miR-139-5p overexpression significantly suppressed HCC cell invasion, whereas inhibition of miR-139-5p enhanced invasion (Fig. 2H). These results suggest that miR-139-5p inhibits HCC progression by effectively suppressing cell migration and invasion.

miR-139-5p targets SMOX and regulates its expression in HCC
Bioinformatics analysis using the miRDB database (http://mirdb.org, Version 6.0) predicted SMOX as a potential target of miR-139-5p, with two miR-139-5p binding sites identified in the 3′ UTR of SMOX. (Fig. 3A). Dual-luciferase reporter assays showed that the miR-139-5p mimic significantly reduced luciferase activity in cells containing the wild-type SMOX 3’ UTR, while no significant change was observed with the mutant 3’ UTR (Fig. 3B). Analysis of TCGA data revealed a significant negative correlation between miR-139-5p and SMOX expression (Spearman’s R = -0.423, P < 0.001). RNA-seq (TPM format) and miRNA-seq (RPM format) data, together with clinical information, were obtained from the TCGA-LIHC project via the TCGA database (https://portal.gdc.cancer.gov). (Fig. 3C). Western blot analysis confirmed that overexpression of miR-139-5p led to a significant reduction in SMOX protein levels in Hep3B and Huh7 cells (P < 0.01, Fig. 3D), verifying that miR-139-5p downregulates SMOX expression through targeting.

SMOX expression and its prognostic significance in HCC
To further investigate the role of SMOX in HCC, we analyzed its expression in HCC tissues and paired normal tissues using TCGA data. Results showed that SMOX expression was significantly higher in HCC tissues compared to normal tissues (Fig. 4B and C). Pan-cancer analysis also indicated high expression of SMOX in various cancer types, including breast cancer, colon cancer, and lung cancer (Fig. 4A). Survival analysis demonstrated that high SMOX expression was associated with poorer overall survival (OS) in HCC patients (Fig. 4D). Western blotting revealed elevated SMOX expression in HCC cells (Fig. 4E), and immunohistochemistry (IHC) analysis showed high SMOX levels in HCC tissues, consistent with TCGA data (Fig. 5F). Furthermore, clinical feature analysis showed that high SMOX expression was significantly associated with adverse prognostic factors, such as pathologic T stage (P = 0.024), pathologic stage (P = 0.016), histologic grade (P = 0.044), and vascular invasion (P = 0.003) (Table 2). These findings suggest that SMOX plays a critical role in HCC progression by promoting cell proliferation and invasion.

SMOX promotes EMT and HCC progression via the AKT-mTOR pathway
SMOX is a key enzyme in polyamine metabolism, and its catalytic reaction generates reactive oxygen species (ROS). Previous studies have reported that ROS can activate the AKT/mTOR signaling pathway27. In turn, the AKT/mTOR pathway has been widely demonstrated to regulate the expression of EMT-related transcription factors, such as Snail and Twist, thereby promoting tumor cell migration and invasion28,29. Given that EMT is a central mechanism of tumor invasion and metastasis, we hypothesized that SMOX may facilitate HCC progression by activating the AKT-mTOR pathway to promote EMT. To test this hypothesis, we analyzed the effects of SMOX on AKT-mTOR signaling activity and EMT marker expression. Western blot analysis showed that SMOX overexpression significantly activated AKT, P-AKT, mTOR, P-mTOR, P70S6K, and P-P70S6K expression, while upregulating mesenchymal markers N-cadherin, vimentin, and Snail, and downregulating the epithelial marker E-cadherin (Fig. 5A). These results suggest that SMOX promotes EMT and accelerates HCC progression by activating the AKT-mTOR pathway. Subsequently, CCK-8 assays demonstrated that SMOX knockdown inhibited HCC cell proliferation, while SMOX overexpression promoted cell proliferation (Fig. 5B). Additionally, SMOX knockdown significantly decreased the migratory capacity of Hep3B and Huh7 cells, slowing wound healing (Fig. 5C). Transwell assays further confirmed that SMOX knockdown suppressed HCC cell invasion, while SMOX overexpression enhanced invasion (Fig. 5D). These data suggest that SMOX plays an important role in regulating HCC cell proliferation, migration, and invasion through the AKT-mTOR pathway.

miR-139-5p inhibits the AKT-mTOR pathway and EMT by targeting SMOX
To confirm that miR-139-5p inhibits HCC progression by regulating SMOX, we conducted rescue experiments. Our results showed that SMOX overexpression partially reversed the inhibitory effects of miR-139-5p on HCC cell proliferation, migration, and invasion (Fig. 6A, C and D). Western blot analysis further revealed that SMOX overexpression partially restored miR-139-5p’s inhibitory effects on AKT, P-AKT, mTOR, P-mTOR, P70S6K, and P-P70S6K activity, while reducing E-cadherin expression and increasing N-cadherin, vimentin, and Snail levels (Fig. 6B). To directly validate the regulatory role of the miR-139-5p/SMOX/AKT-mTOR axis in vivo, we conducted immunohistochemistry (IHC) analysis in miR-139-5p overexpressing and control nude mouse xenograft tumors. The expression of p-Akt, p-mTOR, p-p70S6K, N-cadherin, E-cadherin, vimentin, and Snail in tumor tissues was detected by IHC (Figure SB). The IHC results were consistent with the Western blot findings, confirming that SMOX overexpression restored the activation of the AKT-mTOR pathway and EMT markers. These findings suggest that miR-139-5p inhibits HCC cell proliferation, migration, and invasion by targeting SMOX, thereby regulating the AKT-mTOR pathway and suppressing EMT.

Discussion

Discussion
MicroRNAs (miRNAs), as important non-coding RNA molecules, play a key role in the initiation, progression, and metastasis of tumors30,31. Abnormal miRNA expression in HCC has been identified as a crucial factor in its pathogenesis32. Studies have shown that miRNA expression patterns in HCC are significantly altered. Overexpression of certain miRNAs, such as miR-21 and miR-222, promotes tumor proliferation, invasion, and metastasis by inhibiting tumor suppressor genes (e.g., PTEN, AKT), advancing the cell cycle, and inhibiting apoptosis33–35. In contrast, downregulation of miRNAs like miR-122 and miR-34a is closely associated with HCC development. miR-122 suppresses liver cancer cell proliferation and migration36, while miR-34a, a downstream target of p53, functions as a tumor suppressor37. Therefore, miRNA dysregulation plays a pivotal role in HCC progression. In recent years, the potential of miRNAs in HCC treatment has garnered significant attention. Targeted miRNA therapies show promising preclinical outcomes by either restoring the expression of tumor-suppressive miRNAs or inhibiting the function of tumor-promoting miRNAs. For example, miR-34a mimics can inhibit HCC cell proliferation and induce apoptosis38, while inhibiting miR-21 effectively suppresses tumor growth and metastasis39. Furthermore, the stability and easy detectability of miRNAs in bodily fluids (such as serum and plasma) make them potential biomarkers for early diagnosis and prognostic evaluation of HCC40,41. Reduced expression of miR-122 has been linked to the early onset of liver cancer42. Thus, investigating the molecular mechanisms of miRNAs in tumors offers new directions for HCC treatment and early diagnosis. The combination of targeted miRNA therapies with early screening is expected to bring breakthroughs in precise treatment and intervention for HCC in the future.
This study is the first to reveal the tumor-suppressive role of miR-139-5p in HCC. We explore how miR-139-5p inhibits HCC progression by targeting SMOX, regulating the AKT-mTOR signaling pathway, and modulating EMT. Our findings show that miR-139-5p is significantly downregulated in HCC tissues and cell lines, and its reduced expression correlates with poor prognosis. In contrast, SMOX is highly expressed in HCC, promoting tumor proliferation, migration, and invasion. Initially, we observed that the expression of miR-139-5p in HCC tissues was markedly lower compared to normal tissues, and its downregulation was associated with adverse prognostic factors such as T stage, pathological stage, and vascular invasion. This finding aligns with previous studies indicating that miR-139-5p acts as a tumor suppressor in various cancers43,44. Additionally, miRNAs are known to regulate multiple downstream genes and signaling pathways, playing critical roles in tumor initiation and progression45. Our study provides strong evidence for the specific role of miR-139-5p in HCC.
Further analysis confirmed that SMOX is a target of miR-139-5p. SMOX has been implicated in promoting cancer progression through the enhancement of polyamine metabolism and the generation of reactive oxygen species (ROS), which facilitate tumor cell proliferation and migration. In HCC, high expression of SMOX is closely linked to poor prognosis, suggesting it may serve as a key regulatory factor in HCC progression. Overexpression of miR-139-5p effectively downregulated SMOX expression, thereby inhibiting HCC cell proliferation and invasion. This further corroborates the role of SMOX in HCC. More importantly, we discovered that SMOX promotes HCC progression by activating the AKT-mTOR signaling pathway, a core pathway that regulates cell proliferation, metabolism, and survival in many cancers46. Our experiments showed that SMOX overexpression significantly increased the phosphorylation of AKT, mTOR, and the downstream effector molecule P70S6K, while also activating key EMT markers such as N-cadherin, vimentin, and Snail, while suppressing E-cadherin expression47–49. These results indicate that SMOX enhances HCC invasiveness by promoting EMT, thereby accelerating tumor malignancy.
Restoration experiments demonstrated that miR-139-5p inhibits AKT-mTOR signaling and EMT by downregulating SMOX expression. Overexpression of miR-139-5p significantly reduced AKT and mTOR activity and reversed SMOX-induced EMT. This finding suggests that miR-139-5p not only targets SMOX to suppress its expression but also inhibits HCC progression by blocking its downstream signaling pathways. These insights provide a potential therapeutic strategy targeting miR-139-5p or SMOX in HCC.
Although this study offers new insights into the mechanisms of miR-139-5p in HCC, it has some limitations. Our findings are primarily based on in vitro cell experiments and animal models, and further validation in larger clinical samples is required. Additionally, while we have elucidated the interaction between miR-139-5p, SMOX, and their downstream pathways, the role of SMOX in other signaling networks and its interactions with other molecules remain incompletely understood. Future studies could explore the broader regulatory networks involving SMOX in HCC to gain a more comprehensive understanding of its role in tumor progression.

Conclusion

Conclusion
In conclusion, this study reveals that miR-139-5p inhibits HCC cell proliferation, migration, and invasion by targeting SMOX, thereby suppressing the AKT-mTOR pathway and EMT. Both miR-139-5p and SMOX hold potential as therapeutic targets for HCC, providing valuable insights for the development of novel cancer treatment strategies.

Supplementary Information

Supplementary Information
Below is the link to the electronic supplementary material.

출처: PubMed Central (JATS). 라이선스는 원 publisher 정책을 따릅니다 — 인용 시 원문을 표기해 주세요.

🏷️ 같은 키워드 · 무료전문 — 이 논문 MeSH/keyword 기반

🟢 PMC 전문 열기