본문으로 건너뛰기
← 뒤로

KRAB Zinc-Finger Protein ZNF205 Promotes Hepatocellular Carcinoma via p53 Pathway Repression.

2/5 보강
Cancer science 📖 저널 OA 96.4% 2022: 1/1 OA 2023: 5/5 OA 2024: 13/13 OA 2025: 51/51 OA 2026: 88/94 OA 2022~2026 2026 Vol.117(4) p. 1057-1071 OA Cancer-related Molecular Pathways
TL;DR This study unveils ZNF205 as a novel p53 regulator and establishes its pro‐tumorigenic function in HCC, and expands known KZFP‐mediated p53 inactivation pathways, nominating ZNF205 as a therapeutic target to restore p53 function in HCC.
Retraction 확인
출처
PubMed DOI PMC OpenAlex Semantic 마지막 보강 2026-05-01

PICO 자동 추출 (휴리스틱, conf 2/4)

유사 논문
P · Population 대상 환자/모집단
환자: hepatocellular carcinoma (HCC)
I · Intervention 중재 / 시술
추출되지 않음
C · Comparison 대조 / 비교
추출되지 않음
O · Outcome 결과 / 결론
Our study unveils ZNF205 as a novel p53 regulator and establishes its pro-tumorigenic function in HCC. These results reveal a novel p53 dysregulation mechanism in HCC and expand known KZFP-mediated p53 inactivation pathways, nominating ZNF205 as a therapeutic target to restore p53 function in HCC.
OpenAlex 토픽 · Cancer-related Molecular Pathways Genomics and Chromatin Dynamics Heat shock proteins research

Huang X, Yang Y, Ma Y, Hao W, Jin J, Ding Y

📝 환자 설명용 한 줄

This study unveils ZNF205 as a novel p53 regulator and establishes its pro‐tumorigenic function in HCC, and expands known KZFP‐mediated p53 inactivation pathways, nominating ZNF205 as a therapeutic ta

이 논문을 인용하기

↓ .bib ↓ .ris
APA Xiaofen Huang, Yingchuan Yang, et al. (2026). KRAB Zinc-Finger Protein ZNF205 Promotes Hepatocellular Carcinoma via p53 Pathway Repression.. Cancer science, 117(4), 1057-1071. https://doi.org/10.1111/cas.70337
MLA Xiaofen Huang, et al.. "KRAB Zinc-Finger Protein ZNF205 Promotes Hepatocellular Carcinoma via p53 Pathway Repression.." Cancer science, vol. 117, no. 4, 2026, pp. 1057-1071.
PMID 41668275 ↗
DOI 10.1111/cas.70337

Abstract

The tumor suppressor p53 is frequently dysregulated in cancer, whereas the mechanisms underlying its functional impairment remain unclear. Our previously identified KRAB domain-containing zinc finger proteins (KZFPs) as key p53 regulators in tumorigenesis and progression, specific members and their cancer-relevant mechanistic roles require further characterization. Here, we identified ZNF205, an SQ/TQ motif-bearing KZFP, as a critical oncogenic regulator in HCC. The pan-cancer analysis related to revealed that ZNF205 is an unfavorable prognostic factor for p53 wild-type patients with hepatocellular carcinoma (HCC). ZNF205 interacts with p53 and significantly inhibits its transcriptional activity by impeding the binding of p53 to target genes. Overexpression and knockdown of ZNF205 increase and decrease the malignant phenotype of HCC cells in a p53-dependent manner both in vitro and in vivo, respectively. Our study unveils ZNF205 as a novel p53 regulator and establishes its pro-tumorigenic function in HCC. These results reveal a novel p53 dysregulation mechanism in HCC and expand known KZFP-mediated p53 inactivation pathways, nominating ZNF205 as a therapeutic target to restore p53 function in HCC.

🏷️ 키워드 / MeSH 📖 같은 키워드 OA만

… 외 1개

같은 제1저자의 인용 많은 논문 (5)

📖 전문 본문 읽기 PMC JATS · ~61 KB · 영문

Introduction

1
Introduction
Liver cancer ranks as the sixth most commonly diagnosed malignancy and the third leading cause of cancer‐related mortality worldwide [1]. Hepatocellular carcinoma (HCC), accounting for 75%–85% of primary liver cancer cases [2], develops through complex molecular mechanisms involving dysregulation of critical signaling pathways. Key pathways implicated in HCC pathogenesis include p53 tumor suppressor signaling, Wnt/β‐catenin, AKT/mTOR, and MAPK pathways, which govern fundamental cellular processes such as telomere maintenance, oxidative stress response, and epigenetic regulation [3, 4, 5]. Notably, p53 pathway inactivation emerges as a central driver of HCC development [6, 7].
The p53 protein, a master tumor suppressor encoded by the TP53, coordinates cellular responses to stress signals [8]. Upon activation, p53 transcriptionally regulates target genes to execute tumor‐suppressive functions, including DNA damage repair, cell cycle arrest, apoptosis, and metabolism regulation, thereby maintaining genomic stability [9, 10]. In HCC, p53 dysfunction often results from TP53 mutations or modulator dysregulation [11, 12]. Growing evidence highlights that p53's transcriptional activity is precisely controlled through interactions with various regulatory proteins [13, 14]. For instance, ZNF498 binds p53 to inhibit Ser46 phosphorylation, blocking apoptosis and ferroptosis to promote HCC progression [15]. These findings underscore the importance of identifying novel p53 regulators to elucidate the molecular mechanisms underlying tumorigenesis.
KRAB domain‐containing zinc finger proteins (KZFPs), the largest family of transcriptional regulators in higher vertebrates, act as transcriptional repressors through zinc finger motifs and KRAB domains to regulate diverse biological functions including genomic imprinting, retrotransposon silencing, and carcinogenesis [16, 17, 18]. KZFPs can bidirectionally modulate p53 function either promoting or inhibiting carcinogenesis depending on cellular context. For instance, ZNF307 promotes HCC progression by deacetylating p53, which reduces p53 stability and transcriptional activity [19]. Conversely, ZNF668 inhibits the metastasis of breast cancer by stabilizing p53 through inhibition of ubiquitination‐mediated degradation, consequently enhancing the p53‐mediated DNA damage response [20]. These findings highlight the context‐dependent duality of KZFPs in p53 regulation, underscoring their pivotal yet complex roles in tumor suppression or promotion.
Our previous studies identified multiple KZFPs that regulate p53 activity under various stresses. Following DNA damage, ATM kinase phosphorylates Apak, PITA and PISA at their conserved SQ/TQ motifs, triggering its dissociation from p53 and subsequent p53 activation to induce apoptosis or metabolic responses [21, 22]. Notably, these KZFPs all contain conserved SQ/TQ motifs‐known phosphorylation targets of ATM/ATR kinases that mediate DNA damage response [23, 24]. These findings prompted us to investigate whether additional KZFPs can sense DNA damage stress and selectively regulate p53 activity.
In this study, we systematically screened KZFPs with SQ/TQ motifs and assessed their effects on endogenous p53 transcriptional activity using luciferase reporter assays. We identified ZNF205 as a novel p53‐interacting protein that strongly suppresses p53 transcriptional activity by blocking its binding to target gene promoters. ZNF205 promotes HCC malignancy by inhibiting p53‐dependent expression of apoptosis, cell cycle arrest, and DNA repair factors, driving tumor progression. Clinically, high ZNF205 expression in HCC tissues correlated with poor patient prognosis. These findings establish the ZNF205‐p53 axis as a key driver of HCC progression and a potential therapeutic target.

Materials and Methods

2
Materials and Methods
2.1
Cell Culture and Transfection
The p53+/+ and p53−/− HCT116 cell lines were generously provided by Dr. Qimin Zhan (CAMS & PUMC, Beijing). The HEK293T, HepG2, and Hep3B cell lines were obtained from the ATCC (USA). The p53−/− HepG2, SMMC‐7721, and MHCC‐97H cell lines were maintained in our laboratory. All cells were cultured in DMEM medium with 10% FBS. For transient transfection, plasmids were transfected with the TurboFect reagent (R0532, Thermo Fisher Scientific, USA).

2.2
Plasmids and Reagents
Plasmids containing the full‐length ZNF205 (NM_001042428.2) and p53 (NM_000546.6) following NCBI reference sequences were constructed. Specifically, the ZNF205 gene was cloned into the pcDNA3.1‐myc vector, resulting in a C‐terminal myc‐tagged fusion protein, while the p53 gene was inserted into the pLV‐neo‐flag vector to generate a C‐terminal flag‐tagged fusion protein. The ZNF205 knockout was generated using lentiCRISPR‐v2 (Addgene #52961) with the following sgRNAs: ZNF205‐targeting (5′‐GACGTGCTACGTGATCGACGT‐3′) and control (5′‐GCGATAGCGCTAGCTAGCTAG‐3′). DNA damage‐inducing agent etoposide (S1225) and cisplatin (S1166) were purchased from Selleck Company (Selleck Chemicals, USA).

2.3
Virus Production and Generation of Stable Cell Lines
The transfer vector was co‐transfected with the lentiviral envelope plasmid pMD2.G (#12259, Addgene) and the packaging plasmid psPAX2 (#12260, Addgene) into HEK293T cells. The supernatant containing lentiviral particles was collected 48 h later and used to infect the target cells. The cells were selected using puromycin. Subsequently, monoclonal cells were isolated and evaluated by Western blotting analysis.

2.4
Coimmunoprecipitation (Co‐IP) and Western Blotting Assay
Co‐IP and Western blotting analyses were performed as previously described [25]. For Co‐IP, cells were lysed in a buffer containing 200 mM KCl, 20 mM Tris–HCl (pH 7.9), 5 mM MgCl2, 10% glycerol, 0.2 mM EDTA, 0.1% NP‐40, and protease inhibitor cocktail (S8830, Millipore, USA). Lysates were incubated with specific antibodies or control IgG overnight at 4°C. The immunocomplexes were captured, washed, and eluted in Laemmli sample buffer.
For western blotting, protein extracts were prepared in Laemmli sample buffer, resolved by SDS‐PAGE, and transferred to a nitrocellulose membrane (66485, Pall, USA). Immunoblots were visualized using the Bio‐Rad imaging system. Detailed information of all antibodies used is provided in Table S1.

2.5
In Vitro Glutathione S‐Transferase (GST) Pulldown Assay
For the GST pull‐down assay, the bacterially expressed GST or GST‐ZNF205 proteins were immobilized on glutathione‐Sepharose 4B beads (17‐0756‐01, GE Healthcare, USA) for 4 h and washed with PBS. The beads were incubated with His‐p53, which is expressed in Escherichia coli BL21 and purified using nitrilotriacetic acid agarose beads (013771/34220, CWBIO, Beijing) at 4°C for 4 h. The beads were washed with GST elution buffer, and the eluted proteins were analyzed by Western blotting analysis.

2.6
Gene Reporter Assays
A total of 2 × 104 cells were seeded in a 24‐well culture plate. After 18 h, the firefly reporter gene construct pG13‐Luc (pG13L, containing 13 tandem repeats of p53 binding sites), generously provided by Bert Vogelstein (Johns Hopkins Oncology Center), along with other expression plasmids and the pRL‐TK Renilla luciferase reporter plasmid for normalization (E2241, Promega, USA), were co‐transfected into p53+/+ HCT116 cells. After 48 h, cells were lysed in Passive Lysis Buffer (E1941, Promega, USA). Luciferase activity was measured using the GloMAX 96 microplate luminometer and the Dual‐Luciferase Reporter Assay System. All experiments were performed in triplicate.

2.7
Pan‐Cancer Analysis and Enrichment Analysis
ZNF205 gene expression in normal and tumor tissues was analyzed using TNMplot (https://tnmplot.com/analysis/) [26]. The overall survival (OS) and recurrence‐free survival (RFS) were used to evaluate the prognostic value of ZNF205. Kaplan–Meier (KM) survival analyses in multiple cancers were performed using publicly available RNA‐seq datasets with the KM plotter (https://www.kmplot.com/analysis/) [27], with the best cutoff being auto‐selected. The OS and RFS analyses were generated with the respective hazard ratios (HR) and p‐values (log‐rank test). p‐values < 0.05 were considered statistically significant. A published HCC proteomics dataset was collected and named as “Gao et al.'s cohort” [28].
RNA‐seq analysis of HepG2 cells was performed by Novogene Co. Ltd. (Beijing). Differential gene expression was calculated using R (version 3.6.1) and visualized via volcano plots and heatmaps. Gene Ontology (GO) analysis of differentially expressed genes was performed using the ClusterProfiler package.

2.8
CCK‐8 Assay
Cells were seeded in a 96‐well plate. Cell proliferation was measured daily by adding 10 μL CCK‐8 reagent (CK04, Dojindo CO. Ltd., Japan) and measuring absorbance at 450 nM. Data represent the average of three independent experiments.

2.9
Colony Formation Assay
For the colony formation assay, after transfection, HepG2, MHCC‐7721, Hep3B, and MHCC‐97H cells (2 × 103 per well) were seeded in six‐well plates and cultured in complete medium for 2 weeks. Following incubation, the cells were washed twice with PBS, fixed with 4% paraformaldehyde, and stained with 0.1% crystal violet (Beyotime Biotechnology, Shanghai).

2.10
Transwell Assay
Migration and invasion assays were performed using transwell chambers (8‐μm pore size, BD Biosciences, USA) with either uncoated or matrigel‐coated filters. The invasion and migration assays were performed using 8 × 104 tumor cells seeded into the upper chamber (Matrigel‐coated for invasion, uncoated for migration) and incubated for 36 h at 37°C. Nonmigrated cells were removed, and traversed cells were fixed with methanol and stained with 0.1% crystal violet. The cell count was performed with Image J.

2.11
Organoid Viability Assay
The organoids were derived from primary, spontaneous HCC in a mouse model induced by a dexamethasone‐containing high‐fat diet. The siRNA sequences used were as follows: siZnf205, 5′‐CCAAUCUCAUCGCACAUAATT‐3′, and the nontargeting control siRNA, 5′‐UUCUCCGAACGUGUCACGUTT‐3′. Transfection of siZnf205 and control siRNA was performed using the transfection reagent RNAiMAX (13778030, Thermo Fisher Scientific, USA) according to the manufacturer's instructions [29]. At 72 h posttransfection, after a 10‐min equilibration to room temperature, the viability of mouse HCC organoids was assessed using the Organoid Viability Assay Kit (HY‐K6016, MCE, USA) and the CellTiter‐Glo 3D Cell Viability Assay (G9681, Promega, USA), respectively, following the manufacturers' protocols.

2.12
RT‐qPCR
TRIzol reagent (T9424, Sigma‐Aldrich, USA) was used to lyse the sample, total RNA was obtained, and a cDNA synthesis kit (FSQ‐101, TOYOBO, Japan) was used to perform reverse transcription according to the product specifications. Subsequently, fluorescence quantitative PCR was performed using the Bio‐Rad detection system with Taq Pro Universal SYBR qPCR Master Mix (Q712, Vazyme, Nanjing, China). The expression level of the target genes was normalized to the endogenous reference gene (β‐actin) and calculated using the comparative threshold cycle (2−∆∆Ct) method [15]. All quantitative PCR reactions were conducted in triplicate. The primer sequences are listed in Table S2.

2.13
Chromatin Immunoprecipitation (ChIP)
ChIP assays were performed as described previously [21]. Quantification of precipitated DNA was performed by qPCR. The signals from the ChIP samples were normalized to the corresponding 10% Input DNA control. To assess background binding, a control IP with normal rabbit IgG was included. A genomic region within the GAPDH gene was used as a negative control locus. Enrichment is presented as % Input or as Fold Enrichment over the IgG control. The percentage of immunoprecipitated DNA relative to input was calculated and expressed as the mean ± standard deviation (SD) of three independent experiments. The following primer sequences are presented in Table S3. ChIP assays were performed using the following antibodies: Rabbit anti‐p53 antibody (600 μg/mL, 10442‐1‐AP, Proteintech, USA) and Rabbit IgG antibody (1 mg/mL, 2729, Cell Signaling Technology, USA). Anti‐Flag magnetic beads (FM0500, LabLead, Beijing) were also employed for IP.

2.14
Animal Models
All animal procedures were approved by the Animal Care and Utilization Committee of the Academy of National Center for Protein Sciences (Beijing). Six‐weeks‐old BALB/c nude mice were obtained from Vital River Laboratory (Beijing, China). HepG2 cells overexpressing ZNF205 were resuspended in a 1:1 mixture of PBS and Matrigel (354234, Corning, USA) at a density of 2 × 105 cells per 100 μL. A total of 2 × 105 cells (in 200 μL suspension) were subcutaneously injected into the right flanks, with control cells in the left flanks. At the experimental endpoint (the tumor burden must not exceed 2000 mm3), tumors were excised, photographed, and measured. Tumor volume was calculated using the formula: tumor volume (mm3) = 0.5 × long diameter × (short diameter)2.

2.15
Statistical Analysis
Statistical analysis was performed using GraphPad Prism 8.0. Data are presented as mean ± SD deviation from three independent experiments. For comparisons among multiple groups (> 2), one‐way or two‐way analysis of variance was used, whereas unpaired student t‐test was employed for comparisons between two groups. Survival curves were plotted using the Kaplan–Meier (KM) method, and differences between groups were compared by the log‐rank test. A p < 0.05 indicated statistical significance.

Results

3
Results
3.1
Transcriptional Activity Screening and Protein Interaction Analysis Identify KZFP Containing SQ/TQ Motifs as a Novel Regulator of p53
To systematically identify novel p53 regulatory factors among KZFPs containing DNA damage‐responsive SQ/TQ motifs, we cloned gene fragments from 40 candidate KZFP members into the pCMV‐Myc vector to construct an expression vector for functional screening. Through luciferase reporter gene assay in p53+/+ HCT116 cells, we identified multiple KZFPs capable of suppressing endogenous p53 transcriptional activity, including the five previously characterized regulators ZNF420, ZNF475, ZNF568, ZNF383, and ZNF498, which could significantly decrease p53 activity. Among these, four newly identified members, ZNF554, ZNF713, ZNF205, and ZNF202, demonstrated particularly potent inhibition, each reducing p53 transcriptional activity by > 50% (Figure 1A–C).
Subsequently, to establish a complete interaction landscape, we systematically examined all 40 SQ/TQ‐motif‐containing KZFPs for association with p53 using Co‐IP assays, and identified 22 KZFPs that directly bound to p53 (Figure 1D–F). Subsequent integrative analysis revealed that the four most potent transcriptional suppressors from our functional screen (ZNF554, ZNF713, ZNF205, and ZNF202) were all present among these p53‐interacting partners. Among them, ZNF713 exhibited a weaker interaction with p53 compared to other p53‐interacting KZFPs. Notably, ZNF205 emerged as the top candidate, demonstrating both the strongest association with p53 and the most significant inhibitory effect on p53 transcriptional activity (> 50% suppression) (Figure 1G).

3.2
Clinical Significance of ZNF205 in Hepatocellular Carcinoma
To identify the most biologically relevant tumor context for investigating ZNF205 function, we performed an integrated analysis of TCGA data through the TNMplot platform. Our evaluation focused on cancers demonstrating both significant ZNF205 overexpression in tumor tissues and clinically meaningful associations with patient outcomes. ZNF205 demonstrated significant overexpression in tumor tissues (T/N ratio > 1.5, p < 0.05) of several cancer types, including Bladder Urothelial Carcinoma (BLCA), Kidney Renal Clear Cell Carcinoma (KIRC), Liver Hepatocellular Carcinoma (LIHC), Rectum Adenocarcinoma (READ), and Stomach Adenocarcinoma (STAD) (Figure 2A,B, Table S4). We next evaluated the prognostic value of ZNF205 expression across the five cancer types. High levels of ZNF205 mRNA were significantly associated with diminished overall survival (OS) in BLCA, STAD, and LIHC (HR > 1.5, p < 0.01) (Figure 2B,C, Figure S1, Table S4). Furthermore, analysis of relapse‐free survival (RFS) revealed that, strikingly, this negative correlation was unique to LIHC among the cancers tested (HR > 1.5, p < 0.01) (Figure 2B,D, Figure S2, Table S4).
To validate the correlation between ZNF205 and HCC prognosis, we analyzed an independent proteomic dataset from the Gao et al. cohort [28], which confirmed that ZNF205 overexpression was significantly associated with adverse outcomes (p = 0.037, Figure 2E). Further analysis revealed that high ZNF205 expression predicted significantly worse OS specifically in p53 wild‐type patients (HR = 2.12), those with but not in the p53 mutant subgroups (p = 0.714, Figure 2F,G). To explore if ZNF205 influences other wild‐type p53 cancers, we analyzed its prognostic relevance in breast and colorectal cancer using the KM‐plotter database. ZNF205 expression showed no significant association with survival in breast cancer, irrespective of TP53 statuses (Figure S3A–C). In colorectal cancer, higher ZNF205 expression correlated with better prognosis, an association more pronounced in TP53 mutation patients (Figure S3D–F). These findings suggest that ZNF205 specifically influences HCC prognosis primarily through a p53‐dependent mechanism.

3.3
ZNF205 Directly Binds and Suppresses p53 Transcriptional Activity in Liver Cancer Cells
Then, we will further explore the tumor biological functions of ZNF205 in HCC. We first investigated the ZNF205‐p53 interaction in liver cancer cells. Co‐IP experiments in HepG2 cells transfected with Flag‐tagged p53 and Myc‐tagged ZNF205 confirmed their association (Figure 3A). This interaction was further validated at endogenous and semi‐endogenous protein levels (Figure 3B, Figure S4). GST pull‐down assays using purified recombinant GST‐ZNF205 and His‐p53 proteins demonstrated that ZNF205 binds directly to p53 in vitro (Figure 3C). To identify the interacting regions, we constructed truncation mutants of ZNF205 and p53 based on their respective structural domain compositions. Co‐IP results revealed that the zinc finger domain of ZNF205 and the DNA binding domain of p53 mediated their interactions and are responsible for their mutual interaction (Figure 3D,E).
Since classical DNA damage agents like etoposide and cisplatin activate p53 through ATM‐mediated phosphorylation [21, 30], we investigated the ZNF205‐p53 interaction under genotoxic stress conditions. The ZNF205‐p53 interaction remained unchanged under both treatment conditions (Figure 3F, Figure S5).
We further investigated the effect of ZNF205 on p53 transcriptional activity in liver cancer cells. The results showed that ZNF205 significantly inhibits the transcriptional activity of endogenous p53 in a dose‐dependent manner in p53+/+ HepG2 and SMMC‐7721 (Figure 3G,H). Ectopic expression of ZNF205 in p53−/− Hep3B cells significantly inhibited exogenous p53‐mediated transcriptional activation (Figure 3I). Notably, under genotoxic stress induced by etoposide or cisplatin treatment, ZNF205 maintained persistent interaction with p53 while effectively suppressing its activation potential (Figure 3J,K). These findings collectively establish ZNF205 as a novel negative regulator of p53 transcriptional activity through direct interaction.

3.4
ZNF205 Suppresses p53 Transcriptional Activity by Inhibiting p53 Binding to Target Genes
The tumor suppressor p53 functions as a master transcriptional regulator that orchestrates critical cellular processes including cell cycle regulation, apoptosis, maintenance of genomic stability, and DNA damage response—all fundamental to tumor suppression [12, 31, 32]. To figure out the regulatory function of ZNF205 on p53‐mediated transcription, we first established ZNF205‐knockout HepG2 cells (Figure S6).
RNA‐seq analysis showed that ZNF205 knockdown in HepG2 cells upregulated key p53 effectors, including the pro‐apoptotic gene Bax, the cell cycle regulator p21, the DNA damage response gene GADD45A, and the feedback regulator MDM2, while downregulating nucleotide metabolism enzymes TK1 and TK2 (Figure 4A,B). qPCR assay validation confirmed that ZNF205 overexpression modulated the expression of these target genes in HepG2 and SMMC‐7721 cells. Notably, this regulatory pattern persisted under genotoxic stress conditions (Figure 4C, Figure S7).
To elucidate the molecular mechanism underlying ZNF205‐mediated p53 suppression, we systematically evaluated multiple regulatory levels. We firstly examined the effect of ZNF205 on the protein level of p53 and found that ZNF205 overexpression in HepG2 cells had no significant effect on the total p53 protein levels, either under basal conditions or following etoposide treatment (Figure 4D). Given the established importance of posttranslational modifications (PTMs) in regulating p53 activity [33, 34], we subsequently analyzed the impact of ZNF205 on key p53 PTMs. The results showed that ZNF205 expression did not substantially alter p53 phosphorylation at S15 and S46 or acetylation at K382, regardless of DNA damage status (Figure 4E). Finally, we examined the effect of ZNF205 on the binding of p53 to its target genes. ChIP‐qPCR using anti‐p53 antibody revealed that ZNF205 overexpression significantly decreases p53 occupancy at the regulatory elements of its target genes Puma, p21, and Bax (Figure 4F). Additionally, flag‐tagged ZNF205 was expressed in both p53‐WT and p53‐KO HepG2 cells, followed by ChIP using anti‐Flag magnetic beads and subsequent qPCR analysis of the regulatory regions of canonical p53 target genes (Puma, p21, Bax). The results indicate that ZNF205 does not bind to the regulatory regions of p53 target genes, regardless of the presence or absence of p53 (Figure S8). Considering the previously demonstrated interaction between ZNF205 and the DNA‐binding domain of p53, we propose that ZNF205 likely suppresses p53 transcriptional activity by directly interfering with its DNA‐binding capability through protein–protein interactions.

3.5
ZNF205 Promotes Proliferation, Migration and Invasion of HCC Cells
The above results demonstrated that ZNF205 functions as a negative regulator of p53. Considering the critical tumor‐suppressive role of p53, we further explored whether ZNF205 exerts oncogenic effects in HCC cells. To investigate the functional impacts of ZNF205 on the progression of HCC, we first performed GO analysis of genes downregulated following ZNF205 knockout. The results revealed significant enrichment of genes associated with key biological processes including cell proliferation, cell‐matrix adhesion, nucleotide metabolic processes, and epithelial cell migration signaling pathway, indicating ZNF205's potential involvement in proliferation, invasion, and migration (Figure 5A).
Subsequently, to further functionally characterize ZNF205's oncogenic role, we conducted gain‐ and loss‐of‐function experiments in stably established ZNF205 overexpression and knockdown cells using p53+/+ HepG2 and SMMC‐7721 cells (Figure 5B, Figure S6). Functional assays demonstrated that ZNF205 exerts oncogenic effects in HCC cells. ZNF205 overexpression promoted cell proliferation, colony formation, migration, and invasion in both HepG2 and SMMC‐7721 lines, whereas its knockdown suppressed these capabilities in HepG2 cells (Figure 5C–F).
Furthermore, we utilized a xenograft mouse model to evaluate the oncogenic role of ZNF205 in vivo. At the experimental endpoint, the weight and volume of the xenograft tumors derived from ZNF205 overexpressing HepG2 cells exhibited significantly greater weight and volume compared to controls, confirming ZNF205's tumor‐promoting role in vivo (Figure 5G). Importantly, ZNF205 knockdown inhibited the growth of mouse HCC organoids (Figure 5H, Figures S9 and S10).

3.6
ZNF205 Promotes HCC Progression in a p53‐Dependent Manner
To determine whether ZNF205 exerts its oncogenic effects in a p53‐dependent manner, we established stable ZNF205‐overexpressing in p53‐null Hep3B and p53‐mutant MHCC‐97H cell lines (Figure 6A). Functional analyses revealed that ZNF205 overexpression failed to enhance either cell proliferation (Figure 6B,C) or invasive capacity (Figure 6D,E) in these p53‐deficient cell lines. Notably, reintroduction of wild‐type p53 in Hep3B cells suppressed cell growth and abrogated ZNF205‐mediated growth promotion (Figure 6F). Consistent with findings in p53‐knockout HepG2 cells, ZNF205 overexpression showed no growth‐accelerating effects unless p53 was reintroduced (Figure 6G). Notably, reintroduction of the p53R175H mutant did not restore the growth‐promoting effects mediated by ZNF205 overexpression. Furthermore, p53 reconstitution reversed ZNF205‐induced enhancement of migration and invasion capabilities (Figure 6H,I), whereas the reconstitution of the p53R175H mutant did not reverse these effects. Collectively, these results demonstrate that ZNF205 promotes HCC cell proliferation, migration, and invasion in a strictly p53‐dependent manner.
Given the presence of an SQ/TQ motif at T43, we investigated its functional impact using phosphorylation‐deficient (T43A) and phosphomimetic (T43D) mutants. Unlike the T43A mutant and wild‐type ZNF205, which suppressed p53 activity and promoted malignancy, the T43D mutant had no significant effect on migration or invasion (Figure S11), indicating that phosphorylation at T43 abrogates ZNF205's function.

Discussion

4
Discussion
The regulatory mechanisms of KZFPs proteins containing of SQ/TQ motifs in DNA damage response and selective regulation p53 activity remain poorly characterized. In the study, we identified ZNF205 as a novel and potent suppressor of p53 within the KZFP family. ZNF205 inhibits the transcriptional activity of p53 by selectively impairing its binding to target genes (Figure 7). Clinically relevant, ZNF205 shows significant overexpression in HCC tissues and contributes positively to HCC development.
As the largest family of transcriptional regulators in mammals, KZFPs play pivotal roles in diverse biological processes including embryogenesis, cell differentiation, cell transformation, and cell‐cycle regulation [16, 35]. Emerging evidence reveals the dual nature of KZFPs in cancer. While members like ZNF516, ZNF496, ZNF331, and ZNF575 function as tumor suppressors [25, 36, 37, 38, 39], others including ZNF37A, ZNF248, and ZNF8 promote tumor progression [40, 41, 42]. Our pan‐cancer analysis identified ZNF205 as a consistently overexpressed oncogene. In HCC specifically, its high expression correlated with poor prognosis in a p53‐associated manner and functional knockdown inhibited the proliferation, migration, and invasion ability of HCC cells.
Compared to other well‐studied KZFPs, the molecular mechanisms of ZNF205, particularly in cancer contexts, remain limited. Current knowledge primarily focuses on its antisense long noncoding RNA, ZNF205‐AS1, which forms a positive feedback loop with early growth response factor 4 to drive the growth of nonsmall cell lung cancer progression [43, 44]. Our work provides the first comprehensive characterization of ZNF205 as a transcriptional regulator of p53 with distinct oncogenic properties and mechanisms.
The tumorigenic mechanisms of KZFPs exhibit remarkable diversity. While ZNF217 significantly promotes breast cancer metastasis via TGF‐β/Smad‐mediated epithelial‐mesenchymal transition (EMT) and establishing an autocrine loop [45], ZNF382 suppresses the progression of gastric cancer (GC) by reversing the EMT process in GC cells through the NOTCH signaling pathway [46] Our study reveals that ZNF205 drives the progression of HCC through a unique p53‐dependent mechanism. Unlike other KZFPs that exhibit selective regulation of p53 targets and exert specific p53‐associated functions, such as PITA which inhibits p53‐mediated mitochondrial respiration by modulating SCO2 [22], and ZNF383 which regulates IFN‐β pathway activation by downregulating the expression of IRF5 and ISG15 [47], ZNF205 demonstrates a broader inhibitory effect on p53 transcriptional activity. This inhibition occurs through disruption of p53 binding to multiple downstream targets including Bax, p21, and GADD45A, which are crucial regulators of apoptosis, cell cycle arrest, and DNA repair processes.
While multiple KZNFs regulate the p53 pathway, their molecular mechanisms differ substantially [13, 48]. Notably, ZNF498 inhibits apoptosis through competitive binding with p53INP1, thereby preventing PKCδ‐mediated p53 phosphorylation at Ser46 [15]. In contrast, ZNF668 stabilizes the p53 protein by blocking MDM2‐dependent ubiquitination, consequently suppressing breast cancer metastasis [20]. Distinct from these mechanisms, ZNF205 regulates p53 activity by specifically attenuating p53‐DNA binding capability through protein–protein interactions, thereby potentiating HCC cell proliferation, migration, and invasion. This mechanistic diversity highlights the sophisticated regulatory network governing p53 activity in cancer progression.
As a central mediator of cellular stress response, p53 is regulated by KZFPs with distinct dynamics [21, 48]. Unlike inhibitors such as Apak and PITA, which dissociate from p53 upon stress to enable its activation [21, 22], ZNF205 resembles another KZFP protein, ZNF383, in maintaining a relatively stable interaction with p53 under various stress conditions [47]. It is noteworthy that the phosphorylation‐deficient ZNF205‐T43A mutant, like the wild‐type protein, significantly suppressed p53 activity and promoted cell migration, invasion, and proliferation, whereas the phosphomimetic T43D mutant lost these effects. Although the upstream signals and kinase responsible for T43 phosphorylation remain unknown, these findings underscore the context‐dependent complexity of ZNF205 in p53 regulation.
Sequence alignment showed 69% sequence identity between human and mouse ZNF205. Though N‐terminal regions differ, both retain the classic KRAB domain, and all C2H2 zinc‐finger DNA‐binding domains are highly conserved in sequence, number, and arrangement. This conservation of core functional domains was functionally confirmed, as ZNF205 knockdown significantly reduced viability in mouse‐derived HCC organoids. These results strongly indicate conserved ZNF205 function across species, providing a molecular basis for cross‐species study of its oncogenic potential.
Certainly, beyond its role as a regulator of p53, ZNF205 may possess other molecular functions. This is evidenced by the observation that in breast and colorectal cancers with wild‐type p53, ZNF205 shows either no correlation or even a positive correlation with patient prognosis. The additional molecular functions of ZNF205 warrant further investigation in subsequent studies.
In summary, our findings reveal ZNF205 as a novel therapeutic target in p53‐wild type HCC, where it drives tumor progression through sustained p53 inhibition—even under genotoxic stress. The strong association between ZNF205 overexpression and poor prognosis highlights its dual potential as both a prognostic biomarker and a target for p53 pathway reactivation. Future studies should focus on developing ZNF205 inhibitors and evaluating their therapeutic efficacy in preclinical models.

Author Contributions

Author Contributions

Xiaofen Huang: data curation, software, validation, writing – original draft. Yingchuan Yang: data curation, validation. Yuan Ma: software, validation. Wei Hao: validation. Jingzhuo Jin: validation. Yue Ding: validation. Yiming Zhang: writing – review and editing. Xiuyuan Zhang: methodology, validation. Xinli Li: software. Qin Song: validation. Jiaqi Liu: validation. Bingxin Liu: methodology. Yuanjun Zhai: methodology. Chunling Zhao: conceptualization, supervision. Jin Wu: investigation, supervision. Chunyan Tian: funding acquisition, software, supervision, writing – original draft, writing – review and editing.

Funding

Funding
This work was supported by the National Key R&D Program (2024YFA1307704), the National Natural Science Foundation Projects (82573043, 81572578) of China, and the National Natural Science Foundation of Shandong (ZR2021MH174).

Ethics Statement

Ethics Statement
This study was approved by the Institutional Animal Care and Use Committee (IACUC) of the National Center for Protein Sciences (Beijing).

Consent

Consent
The authors have nothing to report.

Conflicts of Interest

Conflicts of Interest
The authors declare no conflicts of interest.

Supporting information

Supporting information

Figure S1: The correlation between ZNF205 expression and OS in patients with BLCA, KIRC, READ, and STAD.

Figure S2: Association between ZNF205 expression and RFS in multiple tumor types.

Figure S3: The prognostic correlation of ZNF205 in breast cancer and colorectal cancer patients with different TP53 statuses.

Figure S4: Interaction between exogenous ZNF205 and endogenous p53 in HepG2 cells.

Figure S5: Genotoxic stress does not affect the ZNF205‐p53 interaction.

Figure S6: Characterization of HepG2 cells with stable ZNF205 knockout.

Figure S7: ZNF205 modulates p53 target gene expression in SMMC‐7721 cells.

Figure S8: Effect of ZNF205 overexpression on p53 binding to target gene (Puma, p21, Bax) promoters in p53‐WT and p53‐knockout HepG2 cells.

Figure S9: Validation of Znf205 knockdown in mouse‐derived organoids.

Figure S10: Znf205 knockdown suppresses HCC organoid growth.

Figure S11: Phosphorylation at T43 attenuates the function of ZNF205 in regulating p53 activity and cellular behaviors.

Table S1: List of antibodies used in the study.

Table S2: Primer sequence of qPCR assay.

Table S3: Primer sequence of ChIP‐qPCR assay.

Table S4: Statistical data of ZNF205 in pan‐cancer analysis.

출처: PubMed Central (JATS). 라이선스는 원 publisher 정책을 따릅니다 — 인용 시 원문을 표기해 주세요.

🏷️ 같은 키워드 · 무료전문 — 이 논문 MeSH/keyword 기반

🟢 PMC 전문 열기