multiplexed modeling reveals diverse roles of the TBX2 subfamily and in -driven lung adenocarcinoma.
2/5 보강
TL;DR
Findings indicate that Egr1 may play a role in suppressing tumor growth through modulating immune dynamics, offering new insights into the interplay between tumor progression and immune regulation in lung adenocarcinoma.
OpenAlex 토픽 ·
RNA modifications and cancer
Cancer Genomics and Diagnostics
Epigenetics and DNA Methylation
Findings indicate that Egr1 may play a role in suppressing tumor growth through modulating immune dynamics, offering new insights into the interplay between tumor progression and immune regulation in
APA
Athar Khalil, Trang Dinh, et al. (2026). multiplexed modeling reveals diverse roles of the TBX2 subfamily and in -driven lung adenocarcinoma.. Genes & diseases, 13(3), 101840. https://doi.org/10.1016/j.gendis.2025.101840
MLA
Athar Khalil, et al.. " multiplexed modeling reveals diverse roles of the TBX2 subfamily and in -driven lung adenocarcinoma.." Genes & diseases, vol. 13, no. 3, 2026, pp. 101840.
PMID
41705258 ↗
Abstract 한글 요약
The TBX2 subfamily of T-box transcription factors (, , , , ) plays an essential role in lung development. Down-regulation of these genes in human lung adenocarcinoma suggests that these genes may be tumor-suppressive; however, because down-regulation appears to occur primarily via epigenetic change, it remains unclear if these changes causally drive tumor progression or are merely the consequence of upstream events. Herein, we developed the first multiplexed mouse model to study the impact of TBX2 subfamily loss, alongside associated signaling genes (, , , and ) in -driven lung cancer. Using tumor-barcoding with high-throughput barcode sequencing (TuBa-seq), a high-throughput tumor-barcoding system, we quantified the growth effects of these knockouts during early and late tumorigenesis. knockout suppressed both tumor initiation and progression, whereas knockout enhanced tumor initiation and overall tumor growth. loss showed stage-specific effects on tumor development. Notably, emerged as a strong tumor suppressor and its knockout resulted in approximately a fivefold increase in tumor size at 20 weeks (two-sample -test, < 0.05), exceeding the impact observed with loss. Transcriptomic analyses of -deficient tumors suggested immune dysregulation, including heightened inflammation and potential markers of T cell exhaustion in the tumor microenvironment. These findings indicate that may play a role in suppressing tumor growth through modulating immune dynamics, offering new insights into the interplay between tumor progression and immune regulation in lung adenocarcinoma.
🏷️ 키워드 / MeSH 📖 같은 키워드 OA만
같은 제1저자의 인용 많은 논문 (2)
📖 전문 본문 읽기 PMC JATS · ~62 KB · 영문
Introduction
Introduction
Lung adenocarcinoma (LUAD) is a genetically diverse cancer driven by numerous oncogenic and tumor-suppressive events.1 The T-box gene family, comprising eighteen members in mammals, encodes transcription factors that are crucial for embryonic development and tissue homeostasis.2,3 The four members of the TBX2 subfamily (Tbx2, Tbx3, Tbx4, and Tbx5) play an indispensable role in lung development, with their expression being crucial for various aspects of normal lung morphogenesis and differentiation.4, 5, 6, 7 In previous studies, we observed marked down-regulation of the TBX2 subfamily genes in clinical LUAD specimens. The down-regulation of these genes appears to be predominantly mediated by epigenetic mechanisms, particularly DNA methylation dysregulation.8,9 Because these clinical analyses are inherently correlative, it remains unclear whether the down-regulation of these genes causally drives tumor progression or is merely a consequence of broader transcriptional reprogramming. Reactivation of these genes in LUAD cell lines led to reduced cell growth, suggesting a potential tumor suppressive function.10 This effect is amplified in the presence of a Kirsten rat sarcoma viral oncogene homolog (KRAS) mutation, the most common oncogenic event in human LUAD.11 In other cancer types, TBX2 genes play a differential role in regulating cell cycle progression, proliferation, senescence, apoptosis, inflammation, and metastasis.12 With such a diverse and central role in cancer, these genes were shown to function as either oncogenes or tumor suppressors depending on the cellular context (Fig. 1A).13, 14, 15 Hence, faithful models of TBX2 gene loss in an in vivo lung environment are needed to understand the causal role of these genes in LUAD, particularly in the context of Kras-driven oncogenesis.
Herein, we developed the first multiplexed mouse model to study TBX2 subfamily loss along with potential downstream effector genes (Egr1, Chd2, Tnfaip3a, and Atf3) identified through our in vitro studies in Ras-driven lung cancer.10 Our approach combines tumor-barcoding with high-throughput barcode sequencing (TuBa-seq).16 Tumor initiation was carried out using pools of barcoded Lenti-sgRNA/Cre viruses, and the resulting tumors were analyzed at two distinct time points, thereby comprehensively assessing multiple stages of tumorigenesis, including tumor initiation, growth, and progression of KrasG12D-driven lung tumors, across nine distinct genotypes. Notably, early growth response 1 (Egr1) emerged as a critical regulator, with its loss having a more pronounced impact on tumor progression than the loss of the well-established tumor suppressor gene retinoblastoma 1 (Rb1).
Lung adenocarcinoma (LUAD) is a genetically diverse cancer driven by numerous oncogenic and tumor-suppressive events.1 The T-box gene family, comprising eighteen members in mammals, encodes transcription factors that are crucial for embryonic development and tissue homeostasis.2,3 The four members of the TBX2 subfamily (Tbx2, Tbx3, Tbx4, and Tbx5) play an indispensable role in lung development, with their expression being crucial for various aspects of normal lung morphogenesis and differentiation.4, 5, 6, 7 In previous studies, we observed marked down-regulation of the TBX2 subfamily genes in clinical LUAD specimens. The down-regulation of these genes appears to be predominantly mediated by epigenetic mechanisms, particularly DNA methylation dysregulation.8,9 Because these clinical analyses are inherently correlative, it remains unclear whether the down-regulation of these genes causally drives tumor progression or is merely a consequence of broader transcriptional reprogramming. Reactivation of these genes in LUAD cell lines led to reduced cell growth, suggesting a potential tumor suppressive function.10 This effect is amplified in the presence of a Kirsten rat sarcoma viral oncogene homolog (KRAS) mutation, the most common oncogenic event in human LUAD.11 In other cancer types, TBX2 genes play a differential role in regulating cell cycle progression, proliferation, senescence, apoptosis, inflammation, and metastasis.12 With such a diverse and central role in cancer, these genes were shown to function as either oncogenes or tumor suppressors depending on the cellular context (Fig. 1A).13, 14, 15 Hence, faithful models of TBX2 gene loss in an in vivo lung environment are needed to understand the causal role of these genes in LUAD, particularly in the context of Kras-driven oncogenesis.
Herein, we developed the first multiplexed mouse model to study TBX2 subfamily loss along with potential downstream effector genes (Egr1, Chd2, Tnfaip3a, and Atf3) identified through our in vitro studies in Ras-driven lung cancer.10 Our approach combines tumor-barcoding with high-throughput barcode sequencing (TuBa-seq).16 Tumor initiation was carried out using pools of barcoded Lenti-sgRNA/Cre viruses, and the resulting tumors were analyzed at two distinct time points, thereby comprehensively assessing multiple stages of tumorigenesis, including tumor initiation, growth, and progression of KrasG12D-driven lung tumors, across nine distinct genotypes. Notably, early growth response 1 (Egr1) emerged as a critical regulator, with its loss having a more pronounced impact on tumor progression than the loss of the well-established tumor suppressor gene retinoblastoma 1 (Rb1).
Materials and methods
Materials and methods
Mice and tumor initiation
All animal experiments conducted in this study received approval from the Institutional Animal Care Facility at Case Western Reserve University, under protocol number 2020-0099. KrasLSL−G12D; Rosa26CAG−LSL-Cas9−GFP mice have been described.17,18 Mice were on a mixed BL6/129 background. Approximately equal numbers of males and females were used for each experiment. The corresponding figure legends specify the number of mice used in each experiment. Lung tumor initiation was achieved through intratracheal administration of viral-Cre vectors, following the established protocol.19 Ketamine/xylazine drugs were used for anesthesia before the intubation step, and atipamezole was used directly afterwards as a reversal drug. The assessment of tumor burden encompassed various methodologies, including fluorescence microscopy, lung weight measurements, and histological analyses, all of which are comprehensively detailed in the appropriate sections of this study.
Design and generation of Lenti-sgRNA/Cre vectors
We designed lentiviral vectors to encompass Cre alongside single guide RNAs (sgRNAs) targeting specific genes under investigation (putative tumor suppressors and controls) in LUAD. These genes included Tbx2, Tbx3, Tbx4, Tbx5, Egr1, Tnfaip3, Chd2, and Atf3 (Table S1). Additionally, vectors carrying inert guides sgNeo1 and sgNeo2 were generated as internal controls. For validation purposes, sgRb1 served as a positive control, while an sgRNA targeting proliferating cell nuclear antigen (Pcna), an essential gene, acted as a negative control. The sgRNA sequences were meticulously crafted using CRISPRpick. We identified all feasible 20-bp sgRNAs with an NGG protospacer-adjacent motif (PAM) targeting each tumor suppressor gene. These sgRNAs were evaluated for predicted on-target cutting efficiency through an sgRNA design/scoring algorithm. From this analysis, two unique sgRNAs per tumor suppressor gene were selected, prioritizing those with the highest predicted cutting efficiencies. Preference was given to sgRNAs targeting exons conserved across all known splice isoforms (ENSEMBL), positioned closest to splice acceptor or donor sites, located earliest in the gene-coding region, and situated upstream of annotated functional domains (InterPro; UniProt) (Table S1).
The Lenti-U6-sgRNA-sgID-barcode-Pgk-Cre vector was cloned in collaboration with Genewiz. Initially, the sgRNA sequence of the pLenti-sgRb1/Cre vector (Addgene #89647) was replaced by GCGAGGTATTACCGGCGTATCATCCGCG using site-directed mutagenesis, thereby creating pLenti-BaeI-Pgk-Cre. This replacement sequence incorporated a recognition site for the type IIS restriction endonuclease BaeI, facilitating swift replacement of the sgRNA sequence. Subsequently, forward and reverse single-stranded oligonucleotides containing the sgRNA sequence and complementary overhangs were annealed and ligated into the BaeI-linearized pLenti-BaeI-Pgk-Cre vector utilizing T4 DNA ligase. The barcode oligo primer, featuring the 8-nucleotide sgID sequence and 20-nucleotide degenerate barcode, was generated and ligated into the vectors according to established protocols.16
Production, purification, and titering of lentivirus
To prevent barcode-sgRNA uncoupling due to lentiviral template switching during reverse transcription of the pseudo-diploid viral genome, individual barcoded Lenti-sgRNA/Cre vectors were generated separately.20 HEK293T cells were cultured in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum and transfected with each of our barcoded Lenti-sgRNA/Cre plasmids, along with pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455) packaging plasmid, using polyethylenimine. Following transfection, the cells were treated with 20 mM sodium butyrate after 8 h, the culture medium was changed 24 h later, and supernatants were collected at 36 h and 48 h after transfection. Cell debris was removed using a 0.45 μm syringe filter unit (Millipore SLHP033RB), and each lentiviral vector was concentrated by ultracentrifugation at 25,000 rpm at 4 °C for 1.5 h. The concentrated virus was resuspended in phosphate-buffered saline and stored at −80 °C. Vector titers were determined by transducing Rosa26LSL-YFP mouse embryonic fibroblasts with 10 μL of each Lenti-sgRNA/Cre vector, assessing the percentage of YFP-positive cells via flow cytometry, and normalizing the titer to a lentiviral preparation with a known titer. At least 50 k cells were sorted per sample. The cell line was confirmed negative for mycoplasma contamination. Lentiviral vectors were thawed and pooled immediately before administration to mice.
Genomic DNA isolation from mouse lungs
Genomic DNA extraction was carried out from bulk tumor-bearing lung tissue obtained from each mouse. Before tissue homogenization, six benchmark control cell lines, comprising approximately 1 × 105 cells for three cell lines and 100 cells for three cell lines, each carrying unique sgID-BCs, were introduced (“spiked-in”) to every sample, as previously described.36 This addition facilitated the subsequent calculation of the absolute number of neoplastic cells in each tumor based on the sgID-BC reads. The entire lung tissues or right lobe from each mouse, along with the benchmark cell lines, underwent homogenization using a gentleMACS dissociator. Homogenization was performed in 6 mL lysis buffer (100 mM NaCl, 20 mM Tris, 10 mM EDTA, 0.5% SDS) supplemented with 200 μL of 20 mg/mL proteinase K (Life Technologies, AM2544). The homogenized tissue was incubated at 55 °C overnight. Subsequently, DNA extraction was carried out through phenol–chloroform extraction and ethanol precipitation from approximately 1/6th of the total lung lysate using standard protocols. DNA concentrations were determined using a nanodrop.
Library construction and sequencing of sgID-BC for quantitative analysis
Libraries were prepared through the amplification of the sgID-BC region from 32 μg of genomic DNA per mouse. The sgID-BC region of the integrated Lenti-sgRNA-BC/Cre vectors underwent PCR amplification using primer pairs that include TruSeq Illumina adapters and a 5′ multiplexing tag (TruSeq i7 index region indicated in bold). This amplification utilized a universal forward primer (5′ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCGCACGTCTGCCGCGCTG 3′) and a unique reverse primer (5′ CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGACTTCAGACGTGTGCTCTTCCGATCCAGGTTCTTGCGAACCTCAT 3′).
A single-step PCR amplification of sgID-BC regions was employed, proving to be a highly reproducible and quantitative method for determining the neoplastic cell count in each tumor. For each mouse, eight 100 μL PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) were conducted using Q5 High-Fidelity 2 × Master Mix (New England Biolabs, M0494X). The resulting PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter, A63881) using a double size selection protocol.
The concentration and quality of the purified libraries were assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, G2939BA). The libraries were pooled based on lung weight for even sequencing depth distribution, cleaned up, size-selected using AMPure XP beads, and sequenced on the Illumina® HiSeq 2500 platform, generating Paired-End 150 bp reads (PE150) (Novoegene). To enhance sequencing diversity and improve quality, 15%–25% PhiX control DNA was added to the library at the beginning of the sequencing reads.
Quantification of tumor cell number from tumor barcode sequencing
High-quality PE150 reads were each aligned to the known reference sequence of the lentiviral construct encapsulating 10 nucleotides flanking the dual barcodes on either side. Alignment to the reference sequence was performed on both the forward and reverse reads using a Striped Smith-Waterman algorithm to ensure lossless extraction of putative barcodes from every read.21 A prespecified scoring matrix including i) nucleotide match = +4, ii) nucleotide mismatch = −2, iii) gap open = −6, and iv) gap extension = −1 was used. Barcodes were then extracted from each of the forward and reverse read alignments with mismatching bases annotated as “N”. Barcodes were then “dereplicated” (tallied), and barcode tallies were removed if the forward and reverse barcode lengths did not match, or the mean alignment score of the entire pileup was below 50%. This lossless dereplication of barcodes followed by filtering based on the global properties of the barcode pileup minimized biases that sequencing fidelity imparts on pileup quantity (e.g., barcodes with homopolymer runs generally exhibit lower PHRED scores), while still ensuring that only true lentiviral barcodes are tallied.
The rate of recurrent read errors was estimated and used to remove spurious barcodes from pileups using an eight-parameter error model: six symmetric substitution rates to/from A, T, C, G, and N; and an Insertion and Deletion rate. These parameters were estimated once from the median rate of observed recurrent read errors descending from the 100 largest barcode pileups in every mouse in this study. The probability that every barcode in this study was a recurrent read error was then estimated by calculating a rate statistic λ from each barcode's nearest neighbor barcode size multiplied by the estimated error rate for the difference between the two barcodes in question (e.g., substitution or InDel). A Poisson distribution was then used to estimate the likelihood that a pileup was a recurrent read error based on this rate statistic and pileups with a likelihood of over 10−10 were filtered from this study (Fig. S1B–S1D). This filtering probability has been used previously.16,22
Guanine-cytosine (GC) content bias during PCR amplification and the likelihood of “barcode collisions” were then estimated for every mouse and Lenti-sgRNA/mBC pool; however, minimal variation across the experiment was observed. A “barcode collision” rate constitutes the likelihood that two lentiviruses with the same barcode pair transduce different cells in the same mouse. The probability of barcode collisions can be estimated based on the frequency with which the same barcodes appear in separate mice in the study (high diversity barcodes appear only once in the entire study, whereas lower diversity barcodes may be observed in two or three mice). The probability of barcode collisions can bias growth estimates if Lenti-sgRNA pools are barcoded with varying efficiency; however, in this study, we did not observe appreciable differences in barcode diversity across sgRNAs. PCR amplification bias was also not observed, as seen previously.16
Absolute tumor numbers were then estimated for every non-filtered barcode pileup in every mouse by simply dividing the read number by the median read number observed for the three spike-in barcodes and multiplying by the known cell number of these barcodes (1 × 105). A minimum cell cutoff of 400 cells yielded tumor size profiles that were highly reproducible across the technical replicates in our study, and minimized variation in median tumor size between the two inert sgRNAs (Neo1 and Neo3).
Comprehensive statistical assessment of tumor progression using TuBa-seq
Previous TuBa-seq analyses found that a single summary statistic could not explain differences in tumor progression observed between different tumor genotypes. In particular, both the quantity of transduced lineages and the size spectrum of distinct genotypes reproducibly vary (e.g., Stk11 loss dramatically increases mean tumor size without appreciably altering tumor number, while phosphatase and tensin (Pten) loss dramatically increases tumor number with only a moderate increase in mean tumor size).23 Size spectrums then reproducibly differ in both the central tendency (mean/median) of growth and the preponderance of exceptionally large tumors, which cannot be explained by any single random process. Because malignancies are only observed at later time points (and most transduced lineages remain premalignant), it is imperative to quantify both the immediate effects of gene loss (mean and/or 50th – 95th percentile) and the ability of a genotype to potentiate clinically-relevant disease (“heavy-tail” tumor burden and/or 99th – 99.99th percentile).
Total tumor quantity, percentiles of tumor size from the 10th to 99.99th percentiles, and parametric summary statistics of size profiles were all calculated for every sgRNA pool in every mouse as described previously.16 Central tendency was estimated using the maximum likelihood estimator (MLE) of the mean for a log-normal distribution, while deviating from a log-normal distribution in the large “heavy” tail of tumor sizes.24 The minimum size cutoff for the Pareto tail of tumor burden was calculated relative to the median tumor size of sgInerts and inferred to be 44.73 times the median for this study. All statistics for active sgRNAs were then divided by their respective statistic for sgInerts within each mouse, and then averaged across all mice in a particular experimental cohort. p-values and confidence intervals for percentiles and parametric statistics were then calculated using two million iterations of the Bootstrap resampling method. p-values for tumor number (tumor initiation) were calculated using Fisher's exact test.
Total RNA isolation protocol from mouse lung tissues and RNA sequencing
Tumor-bearing lung lobes from mice intubated with Lenti-sgEgr1/Cre or Lenti-sgInert/Cre pools were mixed with TRIzol reagent (Invitrogen Life Technologies) and homogenized using a gentleMACS dissociator (Miltenyi Biotec). Subsequently, 1 mL of the lysate was treated with 0.2 mL of chloroform per 1 mL of TRIzol and vigorously shaken for 15–30 s, followed by incubation at room temperature for 2–3 min to induce phase separation. The mixture was then centrifuged at 12,000–16,000 g at 4 °C for 15 min. The RNA-containing aqueous phase was carefully transferred to a new tube, and RNA purification was performed using the Qiagen RNeasy Mini Kit (Qiagen #74104) according to the manufacturer's protocol. RNA quality was assessed based on RNA integrity numbers using a 2100 Bioanalyzer. Sequencing was performed using NovaSeq X Plus Series (PE150) reading 12 G raw data per sample.
Histology and immunohistochemistry
Lung tissue samples were obtained from 1 to 3 mice per cohort, transduced with the Lenti-sgTSPool/Cre pool or individual sgRNAs (sgEgr1 and sgInerts pools). The collected lobes were fixed in 4% paraformaldehyde for 12 h, followed by storage in 1 × phosphate-buffered saline at 4 °C. Subsequently, tissues were paraffin-embedded and sectioned at the University Hospital Histology Core Facility into 4-μm sections. Hematoxylin and eosin staining was conducted for visualization, and tumor sizes were assessed by measuring the longest diameter of each tumor in the hematoxylin-eosin-stained sections using ImageJ software. Immunohistochemical staining was performed using specific antibodies: anti-TTF-1/Nkx2–1 (1:200, abcam, AB76013), anti-CD3 (1:750, AB135372), anti-CD4 (1:1000, AB183685), antiCD8 (1:1000, ab217344), anti-CD19 (1:1000, ab245235), anti-F4/80 (1:100, Invitrogen# 14-4801-85), and anti-Egr1 (1:200, ab6054). Statistical analysis was performed using ImageJ software, with p-values were calculated using the Mann–Whitney U test.
RNA sequencing analysis
Raw sequence reads were processed to remove contaminant DNA, PCR duplicates, and adaptor sequences. Reads with a quality score below Q20 were excluded using CLC Genomics Workbench (v22.0.2). Paired-end reads were then assembled and aligned to the latest human genome reference (Homo sapiens, GRCh38). Transcript assembly and abundance quantification were conducted via StringTie.25 After FPKM (fragments per kilobase of transcript per million mapped reads) normalization with Ballgown,26 different gene expression analysis was conducted with edgeR's exact test (edgeR v4.2.1).27 Pairwise comparisons were performed with edgeR's decideTestsDGE function, and a Benjamini-Hochberg-adjusted p-value cutoff of 0.05 was used to obtain differentially expressed genes (absolute log2 fold-change ≥1). Gene Set Enrichment Analysis (GSEA) was performed using the murine hallmark gene set from MSigDB (v7.5.1)28; significantly enriched pathways had a Benjamini-Hochberg-adjusted p-value ≤0.05 and a minimum gene set size of 10. Data visualizations were conducted through R (v4.4.1) packages. Significantly up-regulated genes underwent Gene Ontology (GO) enrichment analysis using the Metascape tool. Statistically enriched GO terms were identified using cumulative hypergeometric p-values and enrichment scores. Then, a network-based approach was used to identify the most central genes in immunity-related pathways. Specifically, differentially up-regulated genes from the top 18 significantly enriched and immunity-related pathway clusters were analyzed for Maximal Clique Centrality (MCC) using the CytoHubba plug-in of Cytoscape. A comprehensive set of T-cell exhaustion markers was curated from multiple resources, including CellMarker 2.0 and 10X Genomics. Differential expression of 55 curated markers was assessed between Egr1-KO and control samples, and their expression profiles were visualized in a heatmap.
Egr1 knockout and expression analysis using publicly available DepMap and PCAWG datasets
The impact of EGR1 knockout was analyzed using RStudio with data from the DepMap CRISPRGeneEffect dataset, which was integrated with the model dataset to classify cancer types, and with the OmicsSomaticMutations dataset to identify cell lines harboring KRAS mutations. To determine the significance of EGR1 knockout effects, we applied cutoffs of −0.5 and 0.5, as suggested by DepMap. EGR1 expression in clinical samples was evaluated using the Pan-Cancer Analysis of Whole Genomes (PCAWG) dataset. Expression levels in normal lung tissue were compared with those in LUAD by filtering samples based on histology and using DCC project codes to identify normal tissue. Statistical significance between the two groups was calculated using the Wilcoxon signed-rank test.
Mice and tumor initiation
All animal experiments conducted in this study received approval from the Institutional Animal Care Facility at Case Western Reserve University, under protocol number 2020-0099. KrasLSL−G12D; Rosa26CAG−LSL-Cas9−GFP mice have been described.17,18 Mice were on a mixed BL6/129 background. Approximately equal numbers of males and females were used for each experiment. The corresponding figure legends specify the number of mice used in each experiment. Lung tumor initiation was achieved through intratracheal administration of viral-Cre vectors, following the established protocol.19 Ketamine/xylazine drugs were used for anesthesia before the intubation step, and atipamezole was used directly afterwards as a reversal drug. The assessment of tumor burden encompassed various methodologies, including fluorescence microscopy, lung weight measurements, and histological analyses, all of which are comprehensively detailed in the appropriate sections of this study.
Design and generation of Lenti-sgRNA/Cre vectors
We designed lentiviral vectors to encompass Cre alongside single guide RNAs (sgRNAs) targeting specific genes under investigation (putative tumor suppressors and controls) in LUAD. These genes included Tbx2, Tbx3, Tbx4, Tbx5, Egr1, Tnfaip3, Chd2, and Atf3 (Table S1). Additionally, vectors carrying inert guides sgNeo1 and sgNeo2 were generated as internal controls. For validation purposes, sgRb1 served as a positive control, while an sgRNA targeting proliferating cell nuclear antigen (Pcna), an essential gene, acted as a negative control. The sgRNA sequences were meticulously crafted using CRISPRpick. We identified all feasible 20-bp sgRNAs with an NGG protospacer-adjacent motif (PAM) targeting each tumor suppressor gene. These sgRNAs were evaluated for predicted on-target cutting efficiency through an sgRNA design/scoring algorithm. From this analysis, two unique sgRNAs per tumor suppressor gene were selected, prioritizing those with the highest predicted cutting efficiencies. Preference was given to sgRNAs targeting exons conserved across all known splice isoforms (ENSEMBL), positioned closest to splice acceptor or donor sites, located earliest in the gene-coding region, and situated upstream of annotated functional domains (InterPro; UniProt) (Table S1).
The Lenti-U6-sgRNA-sgID-barcode-Pgk-Cre vector was cloned in collaboration with Genewiz. Initially, the sgRNA sequence of the pLenti-sgRb1/Cre vector (Addgene #89647) was replaced by GCGAGGTATTACCGGCGTATCATCCGCG using site-directed mutagenesis, thereby creating pLenti-BaeI-Pgk-Cre. This replacement sequence incorporated a recognition site for the type IIS restriction endonuclease BaeI, facilitating swift replacement of the sgRNA sequence. Subsequently, forward and reverse single-stranded oligonucleotides containing the sgRNA sequence and complementary overhangs were annealed and ligated into the BaeI-linearized pLenti-BaeI-Pgk-Cre vector utilizing T4 DNA ligase. The barcode oligo primer, featuring the 8-nucleotide sgID sequence and 20-nucleotide degenerate barcode, was generated and ligated into the vectors according to established protocols.16
Production, purification, and titering of lentivirus
To prevent barcode-sgRNA uncoupling due to lentiviral template switching during reverse transcription of the pseudo-diploid viral genome, individual barcoded Lenti-sgRNA/Cre vectors were generated separately.20 HEK293T cells were cultured in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum and transfected with each of our barcoded Lenti-sgRNA/Cre plasmids, along with pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455) packaging plasmid, using polyethylenimine. Following transfection, the cells were treated with 20 mM sodium butyrate after 8 h, the culture medium was changed 24 h later, and supernatants were collected at 36 h and 48 h after transfection. Cell debris was removed using a 0.45 μm syringe filter unit (Millipore SLHP033RB), and each lentiviral vector was concentrated by ultracentrifugation at 25,000 rpm at 4 °C for 1.5 h. The concentrated virus was resuspended in phosphate-buffered saline and stored at −80 °C. Vector titers were determined by transducing Rosa26LSL-YFP mouse embryonic fibroblasts with 10 μL of each Lenti-sgRNA/Cre vector, assessing the percentage of YFP-positive cells via flow cytometry, and normalizing the titer to a lentiviral preparation with a known titer. At least 50 k cells were sorted per sample. The cell line was confirmed negative for mycoplasma contamination. Lentiviral vectors were thawed and pooled immediately before administration to mice.
Genomic DNA isolation from mouse lungs
Genomic DNA extraction was carried out from bulk tumor-bearing lung tissue obtained from each mouse. Before tissue homogenization, six benchmark control cell lines, comprising approximately 1 × 105 cells for three cell lines and 100 cells for three cell lines, each carrying unique sgID-BCs, were introduced (“spiked-in”) to every sample, as previously described.36 This addition facilitated the subsequent calculation of the absolute number of neoplastic cells in each tumor based on the sgID-BC reads. The entire lung tissues or right lobe from each mouse, along with the benchmark cell lines, underwent homogenization using a gentleMACS dissociator. Homogenization was performed in 6 mL lysis buffer (100 mM NaCl, 20 mM Tris, 10 mM EDTA, 0.5% SDS) supplemented with 200 μL of 20 mg/mL proteinase K (Life Technologies, AM2544). The homogenized tissue was incubated at 55 °C overnight. Subsequently, DNA extraction was carried out through phenol–chloroform extraction and ethanol precipitation from approximately 1/6th of the total lung lysate using standard protocols. DNA concentrations were determined using a nanodrop.
Library construction and sequencing of sgID-BC for quantitative analysis
Libraries were prepared through the amplification of the sgID-BC region from 32 μg of genomic DNA per mouse. The sgID-BC region of the integrated Lenti-sgRNA-BC/Cre vectors underwent PCR amplification using primer pairs that include TruSeq Illumina adapters and a 5′ multiplexing tag (TruSeq i7 index region indicated in bold). This amplification utilized a universal forward primer (5′ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCGCACGTCTGCCGCGCTG 3′) and a unique reverse primer (5′ CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGACTTCAGACGTGTGCTCTTCCGATCCAGGTTCTTGCGAACCTCAT 3′).
A single-step PCR amplification of sgID-BC regions was employed, proving to be a highly reproducible and quantitative method for determining the neoplastic cell count in each tumor. For each mouse, eight 100 μL PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) were conducted using Q5 High-Fidelity 2 × Master Mix (New England Biolabs, M0494X). The resulting PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter, A63881) using a double size selection protocol.
The concentration and quality of the purified libraries were assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, G2939BA). The libraries were pooled based on lung weight for even sequencing depth distribution, cleaned up, size-selected using AMPure XP beads, and sequenced on the Illumina® HiSeq 2500 platform, generating Paired-End 150 bp reads (PE150) (Novoegene). To enhance sequencing diversity and improve quality, 15%–25% PhiX control DNA was added to the library at the beginning of the sequencing reads.
Quantification of tumor cell number from tumor barcode sequencing
High-quality PE150 reads were each aligned to the known reference sequence of the lentiviral construct encapsulating 10 nucleotides flanking the dual barcodes on either side. Alignment to the reference sequence was performed on both the forward and reverse reads using a Striped Smith-Waterman algorithm to ensure lossless extraction of putative barcodes from every read.21 A prespecified scoring matrix including i) nucleotide match = +4, ii) nucleotide mismatch = −2, iii) gap open = −6, and iv) gap extension = −1 was used. Barcodes were then extracted from each of the forward and reverse read alignments with mismatching bases annotated as “N”. Barcodes were then “dereplicated” (tallied), and barcode tallies were removed if the forward and reverse barcode lengths did not match, or the mean alignment score of the entire pileup was below 50%. This lossless dereplication of barcodes followed by filtering based on the global properties of the barcode pileup minimized biases that sequencing fidelity imparts on pileup quantity (e.g., barcodes with homopolymer runs generally exhibit lower PHRED scores), while still ensuring that only true lentiviral barcodes are tallied.
The rate of recurrent read errors was estimated and used to remove spurious barcodes from pileups using an eight-parameter error model: six symmetric substitution rates to/from A, T, C, G, and N; and an Insertion and Deletion rate. These parameters were estimated once from the median rate of observed recurrent read errors descending from the 100 largest barcode pileups in every mouse in this study. The probability that every barcode in this study was a recurrent read error was then estimated by calculating a rate statistic λ from each barcode's nearest neighbor barcode size multiplied by the estimated error rate for the difference between the two barcodes in question (e.g., substitution or InDel). A Poisson distribution was then used to estimate the likelihood that a pileup was a recurrent read error based on this rate statistic and pileups with a likelihood of over 10−10 were filtered from this study (Fig. S1B–S1D). This filtering probability has been used previously.16,22
Guanine-cytosine (GC) content bias during PCR amplification and the likelihood of “barcode collisions” were then estimated for every mouse and Lenti-sgRNA/mBC pool; however, minimal variation across the experiment was observed. A “barcode collision” rate constitutes the likelihood that two lentiviruses with the same barcode pair transduce different cells in the same mouse. The probability of barcode collisions can be estimated based on the frequency with which the same barcodes appear in separate mice in the study (high diversity barcodes appear only once in the entire study, whereas lower diversity barcodes may be observed in two or three mice). The probability of barcode collisions can bias growth estimates if Lenti-sgRNA pools are barcoded with varying efficiency; however, in this study, we did not observe appreciable differences in barcode diversity across sgRNAs. PCR amplification bias was also not observed, as seen previously.16
Absolute tumor numbers were then estimated for every non-filtered barcode pileup in every mouse by simply dividing the read number by the median read number observed for the three spike-in barcodes and multiplying by the known cell number of these barcodes (1 × 105). A minimum cell cutoff of 400 cells yielded tumor size profiles that were highly reproducible across the technical replicates in our study, and minimized variation in median tumor size between the two inert sgRNAs (Neo1 and Neo3).
Comprehensive statistical assessment of tumor progression using TuBa-seq
Previous TuBa-seq analyses found that a single summary statistic could not explain differences in tumor progression observed between different tumor genotypes. In particular, both the quantity of transduced lineages and the size spectrum of distinct genotypes reproducibly vary (e.g., Stk11 loss dramatically increases mean tumor size without appreciably altering tumor number, while phosphatase and tensin (Pten) loss dramatically increases tumor number with only a moderate increase in mean tumor size).23 Size spectrums then reproducibly differ in both the central tendency (mean/median) of growth and the preponderance of exceptionally large tumors, which cannot be explained by any single random process. Because malignancies are only observed at later time points (and most transduced lineages remain premalignant), it is imperative to quantify both the immediate effects of gene loss (mean and/or 50th – 95th percentile) and the ability of a genotype to potentiate clinically-relevant disease (“heavy-tail” tumor burden and/or 99th – 99.99th percentile).
Total tumor quantity, percentiles of tumor size from the 10th to 99.99th percentiles, and parametric summary statistics of size profiles were all calculated for every sgRNA pool in every mouse as described previously.16 Central tendency was estimated using the maximum likelihood estimator (MLE) of the mean for a log-normal distribution, while deviating from a log-normal distribution in the large “heavy” tail of tumor sizes.24 The minimum size cutoff for the Pareto tail of tumor burden was calculated relative to the median tumor size of sgInerts and inferred to be 44.73 times the median for this study. All statistics for active sgRNAs were then divided by their respective statistic for sgInerts within each mouse, and then averaged across all mice in a particular experimental cohort. p-values and confidence intervals for percentiles and parametric statistics were then calculated using two million iterations of the Bootstrap resampling method. p-values for tumor number (tumor initiation) were calculated using Fisher's exact test.
Total RNA isolation protocol from mouse lung tissues and RNA sequencing
Tumor-bearing lung lobes from mice intubated with Lenti-sgEgr1/Cre or Lenti-sgInert/Cre pools were mixed with TRIzol reagent (Invitrogen Life Technologies) and homogenized using a gentleMACS dissociator (Miltenyi Biotec). Subsequently, 1 mL of the lysate was treated with 0.2 mL of chloroform per 1 mL of TRIzol and vigorously shaken for 15–30 s, followed by incubation at room temperature for 2–3 min to induce phase separation. The mixture was then centrifuged at 12,000–16,000 g at 4 °C for 15 min. The RNA-containing aqueous phase was carefully transferred to a new tube, and RNA purification was performed using the Qiagen RNeasy Mini Kit (Qiagen #74104) according to the manufacturer's protocol. RNA quality was assessed based on RNA integrity numbers using a 2100 Bioanalyzer. Sequencing was performed using NovaSeq X Plus Series (PE150) reading 12 G raw data per sample.
Histology and immunohistochemistry
Lung tissue samples were obtained from 1 to 3 mice per cohort, transduced with the Lenti-sgTSPool/Cre pool or individual sgRNAs (sgEgr1 and sgInerts pools). The collected lobes were fixed in 4% paraformaldehyde for 12 h, followed by storage in 1 × phosphate-buffered saline at 4 °C. Subsequently, tissues were paraffin-embedded and sectioned at the University Hospital Histology Core Facility into 4-μm sections. Hematoxylin and eosin staining was conducted for visualization, and tumor sizes were assessed by measuring the longest diameter of each tumor in the hematoxylin-eosin-stained sections using ImageJ software. Immunohistochemical staining was performed using specific antibodies: anti-TTF-1/Nkx2–1 (1:200, abcam, AB76013), anti-CD3 (1:750, AB135372), anti-CD4 (1:1000, AB183685), antiCD8 (1:1000, ab217344), anti-CD19 (1:1000, ab245235), anti-F4/80 (1:100, Invitrogen# 14-4801-85), and anti-Egr1 (1:200, ab6054). Statistical analysis was performed using ImageJ software, with p-values were calculated using the Mann–Whitney U test.
RNA sequencing analysis
Raw sequence reads were processed to remove contaminant DNA, PCR duplicates, and adaptor sequences. Reads with a quality score below Q20 were excluded using CLC Genomics Workbench (v22.0.2). Paired-end reads were then assembled and aligned to the latest human genome reference (Homo sapiens, GRCh38). Transcript assembly and abundance quantification were conducted via StringTie.25 After FPKM (fragments per kilobase of transcript per million mapped reads) normalization with Ballgown,26 different gene expression analysis was conducted with edgeR's exact test (edgeR v4.2.1).27 Pairwise comparisons were performed with edgeR's decideTestsDGE function, and a Benjamini-Hochberg-adjusted p-value cutoff of 0.05 was used to obtain differentially expressed genes (absolute log2 fold-change ≥1). Gene Set Enrichment Analysis (GSEA) was performed using the murine hallmark gene set from MSigDB (v7.5.1)28; significantly enriched pathways had a Benjamini-Hochberg-adjusted p-value ≤0.05 and a minimum gene set size of 10. Data visualizations were conducted through R (v4.4.1) packages. Significantly up-regulated genes underwent Gene Ontology (GO) enrichment analysis using the Metascape tool. Statistically enriched GO terms were identified using cumulative hypergeometric p-values and enrichment scores. Then, a network-based approach was used to identify the most central genes in immunity-related pathways. Specifically, differentially up-regulated genes from the top 18 significantly enriched and immunity-related pathway clusters were analyzed for Maximal Clique Centrality (MCC) using the CytoHubba plug-in of Cytoscape. A comprehensive set of T-cell exhaustion markers was curated from multiple resources, including CellMarker 2.0 and 10X Genomics. Differential expression of 55 curated markers was assessed between Egr1-KO and control samples, and their expression profiles were visualized in a heatmap.
Egr1 knockout and expression analysis using publicly available DepMap and PCAWG datasets
The impact of EGR1 knockout was analyzed using RStudio with data from the DepMap CRISPRGeneEffect dataset, which was integrated with the model dataset to classify cancer types, and with the OmicsSomaticMutations dataset to identify cell lines harboring KRAS mutations. To determine the significance of EGR1 knockout effects, we applied cutoffs of −0.5 and 0.5, as suggested by DepMap. EGR1 expression in clinical samples was evaluated using the Pan-Cancer Analysis of Whole Genomes (PCAWG) dataset. Expression levels in normal lung tissue were compared with those in LUAD by filtering samples based on histology and using DCC project codes to identify normal tissue. Statistical significance between the two groups was calculated using the Wilcoxon signed-rank test.
Results
Results
Development of the first in vivo lung cancer model of TBX2 subfamily signaling-associated genes using multiplexed CRISPRko and lineage-tracing
To enable CRISPR/Cas9-mediated somatic genome editing within the context of an oncogenic Kras variant, we crossed mice with Cre/lox-activated alleles of KRASG12D (KrasLSL−G12D/+) and Cre/lox-activated Cas9 (R26LSL−Cas9−eGFP/+), hereafter named a KC mouse model.16,29 Tumors were initiated through intratracheal intubation with barcoded pooled-Lenti-sgRNA/Cre vectors targeting the four TBX2 genes (Tbx2, Tbx3, Tbx4, and Tbx5) and four of their associated effector genes identified previously through our in vitro transcriptome profiling (Egr1, Chd2, Tnfaip3a, and Atf3) (Fig. 1A and B).11 The utilized lenti-sgRNA-Pool/Cre pool included control genome-targeting inerts (sgNeo1 and sgNeo2), and positive and negative controls targeting the known tumor suppressor gene Rb1 and the essential gene Pcna, respectively. Each gene was targeted with two unique Lenti-sgRNA/Cre vectors optimized for on-target cutting specificity within the first three exons of the targeted gene (Table S1). To investigate the role of these genes at both early and late tumorigenesis stages, cohorts of mice were evaluated at 6 weeks and 20 weeks after intubation, respectively (Fig. 1B). Lung weights and histological examination revealed fewer visible tumors at 6 weeks, despite these mice receiving higher viral titers (Fig. 1C and D; Fig. S1A). Lung tumors observed at both time points included hyperplastic lesions and adenomas with foci of high-grade/malignant features, all of which stained positively for the lung lineage-defining transcription factor NKX2.1/TTF-1 (Fig. 1C).
Multiplexed quantification of TBX2 gene function in Kras-driven lung tumors
To precisely quantify the growth effects of each gene knockout within the same mouse at all potential tumor sizes (from tens of cells to millions), we stably labeled the genetically diverse tumors with lentiviral-mediated DNA barcodes (termed Tumor Barcoding, TuBa-seq). Tumor sizes and quantities were determined en masse by analyzing genomic DNA extracted from bulk tumor-bearing lung tissue, followed by deep sequencing of the double barcode region, which identifies both the short guide RNA (sgID) and descendants (“million” BarCode, mBC) of every transduced cell. Sequencing performed to an average depth of >107 reads per mouse allowed us to reliably quantify tumor sizes below 400 cells. To translate barcode read tallies to absolute tumor sizes, we spike-in DNA barcodes of known cell number before cell lysis. After barcodes are tallied, we then eliminate spurious tumors and potential technical replicates by generating a statistical model of sequencing errors and barcode diversity (Fig. S1B–S1D). We assessed the impact of knocking out each of the potential tumor suppressor genes by analyzing the distribution of absolute cell numbers for each gene knockout (Fig. 2A). Consistent with histological evaluations, the mean total cell number initiated by either Lenti-sgInerts or Lenti-sgTSGs was significantly higher in the 20-week cohort compared with the 6-week cohort (Fig. S1E). The average total cell number produced by a single sgInert was significantly smaller than the combined mean cell number produced by our studied knockouts, indicating an overall marked acceleration in cellular proliferation.
Lineage tracing uncovered a wide spectrum of effects on tumorigenesis and variability in tumor sizes with a unique profile of growth effects for each tumor suppressor gene knockout (Fig. 2A). Both the mean estimate and 95th percentile of tumor sizes of each gene knockout was highly correlated between the two sgRNAs targeting a gene (r = 0.87 for mean estimate; Fig. 2B; Fig. S1F). Strong correlation of the percentile spectrums of the two Inert sgRNAs for replicates at both 6 and 20 weeks demonstrates excellent reproducibility of our growth profiles (Fig. 2C). Similarly, A quantile–quantile (Q–Q) comparison of each gene knockout against the wild-type (Kras-only) tumor size distribution in each mouse summarizes growth effects across all tumor sizes (Fig. 2D; Fig. S2A). As cataloged previously via TuBa-seq,17 a gene's effects on tumorigenesis reproducibly alter the number of tumor lineages transduced by the same lentiviral pool, the mean/median size of a transduced tumor, and the probability of exceptionally large tumors. These exceptionally large tumors cannot be explained by a single-step Markov process, nor mode of gene-editing (Floxed-allele or CRISPRko), and are consistent with (epi)genetic progression over the time course.16 Hence, we quantified tumor progression via three distinct, previously-vetted progression measures: i) tumor initiation effect (number of barcodes observed), ii) mean growth effect (a MLE of the mean based on a log-normal distribution, LN mean; Fig. S2B), and (iii) effect on advanced progression (total burden of tumors larger than sizes expected from a log-normal distribution; see Materials and Methods). Summary statistics for each gene were reported relative to wild-type summary statistics within each mouse, thereby controlling for extensive variability in tumor growth observed between mice (Fig. 2E).16
Tumor necrosis factor alpha-induced protein 3 (Tnfaip3)-deficient cells showed a marked increase in tumor size after 6 weeks of growth, suggesting a role in early tumor growth but not necessarily in advanced progression (p < 0.05 for 95th – 99th percentiles, and LN mean, bootstrap resampling; see Materials and Methods) (Fig. 2D). Tnfaip3, also known as A20, is a key anti-inflammatory enzyme and a critical regulator of inflammation homeostasis. Prior studies have demonstrated that the intrinsic loss of A20 in tumor cells markedly enhances lung tumorigenesis and impairs CD8+ T cell-mediated immune surveillance in both patients and murine models.30
The profile of Tbx2-deficient cells exhibited a unique pattern, with an increase in tumor initiation capacity and relative sizes of smaller percentiles, accompanied by a significant decrease in overall LN mean at 6 weeks and the largest percentiles (Fig. 2D). Furthermore, this knockout led to the formation of some of the largest tumors observed in our screen at 20 weeks. Countervailing context-dependent effects of gene knockouts on growth have been observed previously and are consistent with known Tbx2 biology. Inappropriate activation of Tbx2 is thought to contribute to tumor progression by overriding senescence, thereby sustaining tumor growth. TBX2 overexpression has been observed in pancreatic, colorectal, melanoma, endometrial, ovarian, and cervical cancers, where it contributes to tumorigenesis.15 Conversely, other lung and skin cancer models have shown that Tbx2 overexpression inhibits cell growth while being associated with increased resistance of tumor cells to the anti-cancer drug cisplatin, consistent with a highly contextual role of Tbx2 in cancer progression.31
Loss of Tbx3, Tbx4, Tbx5, and activating transcription factor 3 (Atf3) exhibited only marginal growth effects in Ras-driven tumors, similar to their marginal effects on absolute cell number (Fig. 2D and E). Chromodomain helicase DNA binding protein 2 (Chd2) loss consistently resulted in suppressed cellular proliferation with a reduction in total cell number at top percentiles and a significant decrease in LN mean at the studied time point. In general, inactivation of CHD family members has been implicated in various human cancers. Notably, CHD2 has been suggested to play a role in preventing breast cancer initiation. In lung cancer, CHD2 mRNA expression has been linked to cancer stage, particularly in lung squamous cell carcinoma.32
Lastly, deactivation of Egr1, a Tbx2 partner and a direct regulator of key tumor suppressors such as Tgfβ1, Pten, and Tp53, increased mean growth rates at both early and late time points and resulted in exceptionally large tumors at 20 weeks after initiation (∼5 × size increase, two sample t-test, p < 0.05), surpassing even the effect of Rb1 knockout.33 Strikingly, only Egr1 loss significantly promoted all three growth phenotypes, exhibiting this screen's strongest advanced progression phenotype (Fig. 2D and E; Fig. S2B).
Immune pathway modulation and tumor progression following Egr1 suppression in Kras-driven lung cancer
To validate the tumor-suppressive role of Egr1 and investigate its mechanism of action in a Kras-driven background, we generated Egr1-deficient tumors in KC mice by delivering Lenti-sgEgr1-mBC/Cre pools and compared them with Egr1-intact control tumors induced in KC mice using Lenti-sgInert-mBC/Cre pools (Fig. 3A). Twenty weeks after tumor initiation, Egr1-deficient mice developed larger tumors compared with Egr1 controls (Fig. 3B; Fig. S3A).
To investigate the molecular mechanisms of Egr1-driven tumor growth, whole transcriptome comparison between tumor-bearing Egr1-knockout lungs and controls was performed (Fig. S3B). 421 genes were significantly deregulated in Egr1-knockout lung tissues compared with control samples. Unsupervised hierarchical clustering of gene expression profiles revealed distinct differential expression patterns between the groups (Fig. 3C). Nearly all the top up-regulated genes were closely linked to immune responses, inflammation, and chemokine signaling, including Il17a, Itln1, Cd177, Gp2, Cxcl5, and Cxcl13. Gene Ontology (GO) pathway analysis of the differentially up-regulated genes corroborated the immune-modulatory effects of Egr1 loss, with leukocyte migration and activation emerging as the most enriched ontology clusters (Fig. 3D). Building on these findings, MCC analysis further pinpointed the top 12 hub genes within the most enriched immune-related pathways. These genes played critical roles in immune regulation and pathway interconnectivity across the eight primary immune ontology categories (Fig. 4A). Furthermore, GSEA revealed significant enrichment in three immune and inflammatory signaling hallmarks: allograft rejection, interferon gamma response, and interferon alpha response, collectively suggesting that Egr1 deficiency leads to a more immunogenic tumor phenotype. Conversely, although less pronounced, several hallmark tumorigenesis pathways, including Myc, mTOR, and reactive oxygen species (ROS) signaling, were down-regulated in these tumors (Fig. S3C).
We employed three complementary approaches to further explore the impact of Egr1 knockout on lung tumorigenesis and the role of the tumor microenvironment in this process. First, using the PCAWG dataset, we demonstrated significant suppression of EGR1 expression in clinical adenocarcinoma tissues compared with normal lung tissues (Fig. S3D). Next, we quantified the growth effects of EGR1 knockout in human KRAS-driven LUAD cell lines and observed no significant growth differences in the absence of an immune microenvironment (Fig. 4B; Table S2). Additionally, immunohistochemical staining of lung tissues revealed a marked increase in T cell infiltration in Egr1-KO tumor tissues, with robust infiltration of both helper T cells and cytotoxic T cells, indicating an immune response linked to Egr1 loss (Fig. 4C). In contrast, macrophage staining intensity was similar between control and knockout samples, and B cell staining, marked by CD19, was comparable in both groups, although more aggregates were observed in the control samples (Fig. 4C).
To further explore the molecular signature of T cell status in the tumor microenvironment of Egr1-deficient samples, we focused on gene sets associated with T cell exhaustion. Egr1 knockout samples exhibited substantial differential expression, including up-regulation of key T cell exhaustion markers, such as Pdcd1 (PD-1), Cd244 (2B4), Lag3, and Ctla4 (Fig. 4E). These findings suggest a potential transcriptional shift suggestive of T cell exhaustion in the absence of Egr1. However, it is important to note that further detailed analysis using single-cell RNA sequencing or spatial transcriptomics would provide a more comprehensive understanding of the T cell status within the tumor microenvironment, which we plan to address in future studies.
Development of the first in vivo lung cancer model of TBX2 subfamily signaling-associated genes using multiplexed CRISPRko and lineage-tracing
To enable CRISPR/Cas9-mediated somatic genome editing within the context of an oncogenic Kras variant, we crossed mice with Cre/lox-activated alleles of KRASG12D (KrasLSL−G12D/+) and Cre/lox-activated Cas9 (R26LSL−Cas9−eGFP/+), hereafter named a KC mouse model.16,29 Tumors were initiated through intratracheal intubation with barcoded pooled-Lenti-sgRNA/Cre vectors targeting the four TBX2 genes (Tbx2, Tbx3, Tbx4, and Tbx5) and four of their associated effector genes identified previously through our in vitro transcriptome profiling (Egr1, Chd2, Tnfaip3a, and Atf3) (Fig. 1A and B).11 The utilized lenti-sgRNA-Pool/Cre pool included control genome-targeting inerts (sgNeo1 and sgNeo2), and positive and negative controls targeting the known tumor suppressor gene Rb1 and the essential gene Pcna, respectively. Each gene was targeted with two unique Lenti-sgRNA/Cre vectors optimized for on-target cutting specificity within the first three exons of the targeted gene (Table S1). To investigate the role of these genes at both early and late tumorigenesis stages, cohorts of mice were evaluated at 6 weeks and 20 weeks after intubation, respectively (Fig. 1B). Lung weights and histological examination revealed fewer visible tumors at 6 weeks, despite these mice receiving higher viral titers (Fig. 1C and D; Fig. S1A). Lung tumors observed at both time points included hyperplastic lesions and adenomas with foci of high-grade/malignant features, all of which stained positively for the lung lineage-defining transcription factor NKX2.1/TTF-1 (Fig. 1C).
Multiplexed quantification of TBX2 gene function in Kras-driven lung tumors
To precisely quantify the growth effects of each gene knockout within the same mouse at all potential tumor sizes (from tens of cells to millions), we stably labeled the genetically diverse tumors with lentiviral-mediated DNA barcodes (termed Tumor Barcoding, TuBa-seq). Tumor sizes and quantities were determined en masse by analyzing genomic DNA extracted from bulk tumor-bearing lung tissue, followed by deep sequencing of the double barcode region, which identifies both the short guide RNA (sgID) and descendants (“million” BarCode, mBC) of every transduced cell. Sequencing performed to an average depth of >107 reads per mouse allowed us to reliably quantify tumor sizes below 400 cells. To translate barcode read tallies to absolute tumor sizes, we spike-in DNA barcodes of known cell number before cell lysis. After barcodes are tallied, we then eliminate spurious tumors and potential technical replicates by generating a statistical model of sequencing errors and barcode diversity (Fig. S1B–S1D). We assessed the impact of knocking out each of the potential tumor suppressor genes by analyzing the distribution of absolute cell numbers for each gene knockout (Fig. 2A). Consistent with histological evaluations, the mean total cell number initiated by either Lenti-sgInerts or Lenti-sgTSGs was significantly higher in the 20-week cohort compared with the 6-week cohort (Fig. S1E). The average total cell number produced by a single sgInert was significantly smaller than the combined mean cell number produced by our studied knockouts, indicating an overall marked acceleration in cellular proliferation.
Lineage tracing uncovered a wide spectrum of effects on tumorigenesis and variability in tumor sizes with a unique profile of growth effects for each tumor suppressor gene knockout (Fig. 2A). Both the mean estimate and 95th percentile of tumor sizes of each gene knockout was highly correlated between the two sgRNAs targeting a gene (r = 0.87 for mean estimate; Fig. 2B; Fig. S1F). Strong correlation of the percentile spectrums of the two Inert sgRNAs for replicates at both 6 and 20 weeks demonstrates excellent reproducibility of our growth profiles (Fig. 2C). Similarly, A quantile–quantile (Q–Q) comparison of each gene knockout against the wild-type (Kras-only) tumor size distribution in each mouse summarizes growth effects across all tumor sizes (Fig. 2D; Fig. S2A). As cataloged previously via TuBa-seq,17 a gene's effects on tumorigenesis reproducibly alter the number of tumor lineages transduced by the same lentiviral pool, the mean/median size of a transduced tumor, and the probability of exceptionally large tumors. These exceptionally large tumors cannot be explained by a single-step Markov process, nor mode of gene-editing (Floxed-allele or CRISPRko), and are consistent with (epi)genetic progression over the time course.16 Hence, we quantified tumor progression via three distinct, previously-vetted progression measures: i) tumor initiation effect (number of barcodes observed), ii) mean growth effect (a MLE of the mean based on a log-normal distribution, LN mean; Fig. S2B), and (iii) effect on advanced progression (total burden of tumors larger than sizes expected from a log-normal distribution; see Materials and Methods). Summary statistics for each gene were reported relative to wild-type summary statistics within each mouse, thereby controlling for extensive variability in tumor growth observed between mice (Fig. 2E).16
Tumor necrosis factor alpha-induced protein 3 (Tnfaip3)-deficient cells showed a marked increase in tumor size after 6 weeks of growth, suggesting a role in early tumor growth but not necessarily in advanced progression (p < 0.05 for 95th – 99th percentiles, and LN mean, bootstrap resampling; see Materials and Methods) (Fig. 2D). Tnfaip3, also known as A20, is a key anti-inflammatory enzyme and a critical regulator of inflammation homeostasis. Prior studies have demonstrated that the intrinsic loss of A20 in tumor cells markedly enhances lung tumorigenesis and impairs CD8+ T cell-mediated immune surveillance in both patients and murine models.30
The profile of Tbx2-deficient cells exhibited a unique pattern, with an increase in tumor initiation capacity and relative sizes of smaller percentiles, accompanied by a significant decrease in overall LN mean at 6 weeks and the largest percentiles (Fig. 2D). Furthermore, this knockout led to the formation of some of the largest tumors observed in our screen at 20 weeks. Countervailing context-dependent effects of gene knockouts on growth have been observed previously and are consistent with known Tbx2 biology. Inappropriate activation of Tbx2 is thought to contribute to tumor progression by overriding senescence, thereby sustaining tumor growth. TBX2 overexpression has been observed in pancreatic, colorectal, melanoma, endometrial, ovarian, and cervical cancers, where it contributes to tumorigenesis.15 Conversely, other lung and skin cancer models have shown that Tbx2 overexpression inhibits cell growth while being associated with increased resistance of tumor cells to the anti-cancer drug cisplatin, consistent with a highly contextual role of Tbx2 in cancer progression.31
Loss of Tbx3, Tbx4, Tbx5, and activating transcription factor 3 (Atf3) exhibited only marginal growth effects in Ras-driven tumors, similar to their marginal effects on absolute cell number (Fig. 2D and E). Chromodomain helicase DNA binding protein 2 (Chd2) loss consistently resulted in suppressed cellular proliferation with a reduction in total cell number at top percentiles and a significant decrease in LN mean at the studied time point. In general, inactivation of CHD family members has been implicated in various human cancers. Notably, CHD2 has been suggested to play a role in preventing breast cancer initiation. In lung cancer, CHD2 mRNA expression has been linked to cancer stage, particularly in lung squamous cell carcinoma.32
Lastly, deactivation of Egr1, a Tbx2 partner and a direct regulator of key tumor suppressors such as Tgfβ1, Pten, and Tp53, increased mean growth rates at both early and late time points and resulted in exceptionally large tumors at 20 weeks after initiation (∼5 × size increase, two sample t-test, p < 0.05), surpassing even the effect of Rb1 knockout.33 Strikingly, only Egr1 loss significantly promoted all three growth phenotypes, exhibiting this screen's strongest advanced progression phenotype (Fig. 2D and E; Fig. S2B).
Immune pathway modulation and tumor progression following Egr1 suppression in Kras-driven lung cancer
To validate the tumor-suppressive role of Egr1 and investigate its mechanism of action in a Kras-driven background, we generated Egr1-deficient tumors in KC mice by delivering Lenti-sgEgr1-mBC/Cre pools and compared them with Egr1-intact control tumors induced in KC mice using Lenti-sgInert-mBC/Cre pools (Fig. 3A). Twenty weeks after tumor initiation, Egr1-deficient mice developed larger tumors compared with Egr1 controls (Fig. 3B; Fig. S3A).
To investigate the molecular mechanisms of Egr1-driven tumor growth, whole transcriptome comparison between tumor-bearing Egr1-knockout lungs and controls was performed (Fig. S3B). 421 genes were significantly deregulated in Egr1-knockout lung tissues compared with control samples. Unsupervised hierarchical clustering of gene expression profiles revealed distinct differential expression patterns between the groups (Fig. 3C). Nearly all the top up-regulated genes were closely linked to immune responses, inflammation, and chemokine signaling, including Il17a, Itln1, Cd177, Gp2, Cxcl5, and Cxcl13. Gene Ontology (GO) pathway analysis of the differentially up-regulated genes corroborated the immune-modulatory effects of Egr1 loss, with leukocyte migration and activation emerging as the most enriched ontology clusters (Fig. 3D). Building on these findings, MCC analysis further pinpointed the top 12 hub genes within the most enriched immune-related pathways. These genes played critical roles in immune regulation and pathway interconnectivity across the eight primary immune ontology categories (Fig. 4A). Furthermore, GSEA revealed significant enrichment in three immune and inflammatory signaling hallmarks: allograft rejection, interferon gamma response, and interferon alpha response, collectively suggesting that Egr1 deficiency leads to a more immunogenic tumor phenotype. Conversely, although less pronounced, several hallmark tumorigenesis pathways, including Myc, mTOR, and reactive oxygen species (ROS) signaling, were down-regulated in these tumors (Fig. S3C).
We employed three complementary approaches to further explore the impact of Egr1 knockout on lung tumorigenesis and the role of the tumor microenvironment in this process. First, using the PCAWG dataset, we demonstrated significant suppression of EGR1 expression in clinical adenocarcinoma tissues compared with normal lung tissues (Fig. S3D). Next, we quantified the growth effects of EGR1 knockout in human KRAS-driven LUAD cell lines and observed no significant growth differences in the absence of an immune microenvironment (Fig. 4B; Table S2). Additionally, immunohistochemical staining of lung tissues revealed a marked increase in T cell infiltration in Egr1-KO tumor tissues, with robust infiltration of both helper T cells and cytotoxic T cells, indicating an immune response linked to Egr1 loss (Fig. 4C). In contrast, macrophage staining intensity was similar between control and knockout samples, and B cell staining, marked by CD19, was comparable in both groups, although more aggregates were observed in the control samples (Fig. 4C).
To further explore the molecular signature of T cell status in the tumor microenvironment of Egr1-deficient samples, we focused on gene sets associated with T cell exhaustion. Egr1 knockout samples exhibited substantial differential expression, including up-regulation of key T cell exhaustion markers, such as Pdcd1 (PD-1), Cd244 (2B4), Lag3, and Ctla4 (Fig. 4E). These findings suggest a potential transcriptional shift suggestive of T cell exhaustion in the absence of Egr1. However, it is important to note that further detailed analysis using single-cell RNA sequencing or spatial transcriptomics would provide a more comprehensive understanding of the T cell status within the tumor microenvironment, which we plan to address in future studies.
Discussion
Discussion
Most putative driver mutations are altered in <10% of tumors, highlighting the need to understand the functional importance of additional actionable drivers that may be infrequently altered at the genetic level, but often deregulated through expression changes.29 Furthermore, the impact of co-occurring tumor suppressor gene alterations is often overlooked in the molecular classification of tumors. Our study addresses the limitations of current methodologies, which predominantly focus on single-driver oncogenic mutations, thereby neglecting the broader landscape of genetic and epigenetic changes in putative tumor suppressors that could contribute to tumorigenesis. In this context, we applied for the first time TuBa-seq technology to systematically investigate the role of Tbx2 genes and their effectors in vivo. Contrary to gene-centric models of tumor progression, we found that epigenetically dysregulated genes, such as the Tbx2 subfamily, can causally drive or slow tumor progression when deleted. This model provided highly precise and detailed quantification of tumor growth following the inactivation of our targeted genes in Kras-driven lung tumors.
In this study, genes associated with the TBX2 subfamily exhibited distinct roles at different stages of tumor progression. Chd2 knockout inhibited tumor growth, while Tnfaip3 knockout promoted tumor initiation and overall growth. Interestingly, cells deficient in Tbx3, Tbx4, Tbx5, and Atf3 demonstrated minimal effects on tumorigenesis within our experimental model. Consistent with most studies, Tbx2-deficient cells exhibited suppressed growth capacity, yet its knockout significantly contributed to both tumor initiation and advanced progression—two aspects of TBX2's role in tumorigenesis that remain understudied. Tbx2 is known to physically interact and suppress the transcriptional activity of Egr1 (the most significant tumor suppressor gene identified in our study) (Table S3). Egr1 is a zinc-finger transcription factor with multifunctional roles in proliferation, stress responses, and apoptosis.34 In cancers, such as rhabdomyosarcoma and breast cancer, TBX2 exploits this interaction to target several carcinogenic genes, including N-myc downstream-regulated gene 1 (NDRG1), a protein involved in cell differentiation, apoptosis, and senescence (Fig. 1A).23,24
Beyond its relationship with TBX2, EGR1 has been extensively studied in cancer biology. It is activated through the mitogen-activated protein kinase (MAPK) signaling pathway in response to various stimuli, such as growth factors, tumor necrosis factor, hypoxia, inflammatory signals, ionizing radiation, and ROS. Once activated, Egr1 can either promote or suppress the expression of its target genes, influencing transcriptional regulation. As a tumor suppressor in gliomas and melanocytomas, Egr1 up-regulates p21Waf1/Cip1 to induce apoptosis.35 Additionally, Egr1 enhances tumor cell death by directly up-regulating tumor suppressors like NSAID-activated gene 1 (NAG1) and PTEN.33 In the context of immune regulation, Egr1 has been the subject of conflicting reports, with its role oscillating between immunostimulatory and immunosuppressive effects depending on the cellular and environmental context. In inflammatory lung diseases, EGR1 is recognized as a master regulator of transcription, promoting the expression of genes critical for immune signaling and inflammatory cell activation.36,37 Conversely, within macrophages, EGR1 has been found to interact indirectly with the nucleosome remodeling and deacetylase (NuRD) complex, leading to chromatin deacetylation and the suppression of inflammatory enhancer activation, thereby curbing excessive inflammatory responses.36 In the context of KRAS-driven cancer, few studies have explored the role of EGR1. Notably, EGR1 is known to be transcriptionally activated by ERK1/2, a key downstream effector of oncogenic KRAS signaling.38 Supporting a tumor-suppressive role, a study using the LSLKrasˆG12D/+; Pdx1−Cre mouse model of pancreatic cancer demonstrated that δ-tocotrienol treatment induced nuclear EGR1 expression and triggered apoptosis in early ductal lesions, highlighting a protective function for EGR1 in KRAS-mutant tumors.39 Despite its importance, EGR1 remains largely understudied in lung cancer, with existing research primarily limited to clinical surveys and in vitro experiments.40,41 For example, EGR1 expression has been shown to predict PTEN levels and patient survival after surgical resection in non-small cell lung cancer, with lower EGR1 levels correlating with poorer outcomes.41 In this study, we present the first lung-specific Egr1-knockout mouse model, emphasizing its critical role at various stages of LUAD development, particularly in the context of Kras-driven tumorigenesis. Egr1-deficient cells demonstrated enhanced tumor initiation, growth, and progression, with effects exceeding those observed with the loss of Rb1, a key tumor suppressor in LUAD. Our transcriptomic analysis revealed that the tumorigenic effects of Egr1 deficiency were linked to an up-regulation of immune-related genes and a molecular signature suggestive of T cell exhaustion in the tumor microenvironment. However, further investigation is needed to fully understand how Egr1 deficiency in epithelial cells contributes to the onset or exacerbation of T cell exhaustion, offering new insights into the complex immune dynamics within tumors.
In conclusion, our study identifies Egr1 as a key player in lung cancer progression and immune modulation, positioning it as a promising target for immunotherapy or a potential biomarker. We note that this discovery would not have been made were this study limited to i) in vitro or ii) clinical exome-level sequencing analyses, or iii) a single gene within the TBX2 signaling cascade. Hence, this study underscores the indispensable value of systematic in vivo genetic models of cancer, which provide a more comprehensive understanding of gene function and mechanisms.
Most putative driver mutations are altered in <10% of tumors, highlighting the need to understand the functional importance of additional actionable drivers that may be infrequently altered at the genetic level, but often deregulated through expression changes.29 Furthermore, the impact of co-occurring tumor suppressor gene alterations is often overlooked in the molecular classification of tumors. Our study addresses the limitations of current methodologies, which predominantly focus on single-driver oncogenic mutations, thereby neglecting the broader landscape of genetic and epigenetic changes in putative tumor suppressors that could contribute to tumorigenesis. In this context, we applied for the first time TuBa-seq technology to systematically investigate the role of Tbx2 genes and their effectors in vivo. Contrary to gene-centric models of tumor progression, we found that epigenetically dysregulated genes, such as the Tbx2 subfamily, can causally drive or slow tumor progression when deleted. This model provided highly precise and detailed quantification of tumor growth following the inactivation of our targeted genes in Kras-driven lung tumors.
In this study, genes associated with the TBX2 subfamily exhibited distinct roles at different stages of tumor progression. Chd2 knockout inhibited tumor growth, while Tnfaip3 knockout promoted tumor initiation and overall growth. Interestingly, cells deficient in Tbx3, Tbx4, Tbx5, and Atf3 demonstrated minimal effects on tumorigenesis within our experimental model. Consistent with most studies, Tbx2-deficient cells exhibited suppressed growth capacity, yet its knockout significantly contributed to both tumor initiation and advanced progression—two aspects of TBX2's role in tumorigenesis that remain understudied. Tbx2 is known to physically interact and suppress the transcriptional activity of Egr1 (the most significant tumor suppressor gene identified in our study) (Table S3). Egr1 is a zinc-finger transcription factor with multifunctional roles in proliferation, stress responses, and apoptosis.34 In cancers, such as rhabdomyosarcoma and breast cancer, TBX2 exploits this interaction to target several carcinogenic genes, including N-myc downstream-regulated gene 1 (NDRG1), a protein involved in cell differentiation, apoptosis, and senescence (Fig. 1A).23,24
Beyond its relationship with TBX2, EGR1 has been extensively studied in cancer biology. It is activated through the mitogen-activated protein kinase (MAPK) signaling pathway in response to various stimuli, such as growth factors, tumor necrosis factor, hypoxia, inflammatory signals, ionizing radiation, and ROS. Once activated, Egr1 can either promote or suppress the expression of its target genes, influencing transcriptional regulation. As a tumor suppressor in gliomas and melanocytomas, Egr1 up-regulates p21Waf1/Cip1 to induce apoptosis.35 Additionally, Egr1 enhances tumor cell death by directly up-regulating tumor suppressors like NSAID-activated gene 1 (NAG1) and PTEN.33 In the context of immune regulation, Egr1 has been the subject of conflicting reports, with its role oscillating between immunostimulatory and immunosuppressive effects depending on the cellular and environmental context. In inflammatory lung diseases, EGR1 is recognized as a master regulator of transcription, promoting the expression of genes critical for immune signaling and inflammatory cell activation.36,37 Conversely, within macrophages, EGR1 has been found to interact indirectly with the nucleosome remodeling and deacetylase (NuRD) complex, leading to chromatin deacetylation and the suppression of inflammatory enhancer activation, thereby curbing excessive inflammatory responses.36 In the context of KRAS-driven cancer, few studies have explored the role of EGR1. Notably, EGR1 is known to be transcriptionally activated by ERK1/2, a key downstream effector of oncogenic KRAS signaling.38 Supporting a tumor-suppressive role, a study using the LSLKrasˆG12D/+; Pdx1−Cre mouse model of pancreatic cancer demonstrated that δ-tocotrienol treatment induced nuclear EGR1 expression and triggered apoptosis in early ductal lesions, highlighting a protective function for EGR1 in KRAS-mutant tumors.39 Despite its importance, EGR1 remains largely understudied in lung cancer, with existing research primarily limited to clinical surveys and in vitro experiments.40,41 For example, EGR1 expression has been shown to predict PTEN levels and patient survival after surgical resection in non-small cell lung cancer, with lower EGR1 levels correlating with poorer outcomes.41 In this study, we present the first lung-specific Egr1-knockout mouse model, emphasizing its critical role at various stages of LUAD development, particularly in the context of Kras-driven tumorigenesis. Egr1-deficient cells demonstrated enhanced tumor initiation, growth, and progression, with effects exceeding those observed with the loss of Rb1, a key tumor suppressor in LUAD. Our transcriptomic analysis revealed that the tumorigenic effects of Egr1 deficiency were linked to an up-regulation of immune-related genes and a molecular signature suggestive of T cell exhaustion in the tumor microenvironment. However, further investigation is needed to fully understand how Egr1 deficiency in epithelial cells contributes to the onset or exacerbation of T cell exhaustion, offering new insights into the complex immune dynamics within tumors.
In conclusion, our study identifies Egr1 as a key player in lung cancer progression and immune modulation, positioning it as a promising target for immunotherapy or a potential biomarker. We note that this discovery would not have been made were this study limited to i) in vitro or ii) clinical exome-level sequencing analyses, or iii) a single gene within the TBX2 signaling cascade. Hence, this study underscores the indispensable value of systematic in vivo genetic models of cancer, which provide a more comprehensive understanding of gene function and mechanisms.
CRediT authorship contribution statement
CRediT authorship contribution statement
Athar Khalil: Conceptualization, Writing – original draft, Formal analysis, Data curation, Writing – review & editing. Trang Dinh: Formal analysis, Data curation. Meaghan Parks: Formal analysis. Rebecca C. Obeng: Formal analysis. Berkley Gryder: Formal analysis. Adam Kresak: Resources. Yuxiang Wang: Data curation. Jeff Maltas: Formal analysis. Madeline Bedrock: Methodology. Xiangzhen Wei: Methodology. Zachary Faber: Formal analysis. Mira Rahm: Methodology. Jacob Scott: Supervision, Writing – review & editing. Thomas LaFramboise: Writing – review & editing, Supervision. Zhenghe Wang: Funding acquisition, Conceptualization, Writing – review & editing, Supervision. Christopher McFarland: Funding acquisition, Formal analysis, Writing – review & editing, Conceptualization, Methodology.
Athar Khalil: Conceptualization, Writing – original draft, Formal analysis, Data curation, Writing – review & editing. Trang Dinh: Formal analysis, Data curation. Meaghan Parks: Formal analysis. Rebecca C. Obeng: Formal analysis. Berkley Gryder: Formal analysis. Adam Kresak: Resources. Yuxiang Wang: Data curation. Jeff Maltas: Formal analysis. Madeline Bedrock: Methodology. Xiangzhen Wei: Methodology. Zachary Faber: Formal analysis. Mira Rahm: Methodology. Jacob Scott: Supervision, Writing – review & editing. Thomas LaFramboise: Writing – review & editing, Supervision. Zhenghe Wang: Funding acquisition, Conceptualization, Writing – review & editing, Supervision. Christopher McFarland: Funding acquisition, Formal analysis, Writing – review & editing, Conceptualization, Methodology.
Funding
Funding
This work was supported by grants from the 10.13039/100000002US National Institutes of Health (No. R01CA271540, R00CA226506 to C.M.; R01CA196643, R01CA264320, R01CA260629, P50CA150964, P30 CA043703 to Z.W.).
This work was supported by grants from the 10.13039/100000002US National Institutes of Health (No. R01CA271540, R00CA226506 to C.M.; R01CA196643, R01CA264320, R01CA260629, P50CA150964, P30 CA043703 to Z.W.).
Conflict of interests
Conflict of interests
Zhenghe Wang is the member of Genes & Diseases Editorial Board. To minimize bias, he was excluded from all editorial decision-making related to the acceptance of this article for publication. The remaining authors declare no conflict of interests.
Zhenghe Wang is the member of Genes & Diseases Editorial Board. To minimize bias, he was excluded from all editorial decision-making related to the acceptance of this article for publication. The remaining authors declare no conflict of interests.
출처: PubMed Central (JATS). 라이선스는 원 publisher 정책을 따릅니다 — 인용 시 원문을 표기해 주세요.