본문으로 건너뛰기
← 뒤로

Structural and mechanistic analysis of covalent ligands targeting the RNA-binding protein NONO.

1/5 보강
Cell chemical biology 2026 Vol.33(2) p. 256-267.e11
Retraction 확인
출처

Lindsey GL, Hockley TK, Gomez AV, Marshall AC, Brothers WR, Finney CT, Gross J, Fox AH, Yeo GW, Melillo B, Bond CS, Cravatt BF

📝 환자 설명용 한 줄

RNA-binding proteins (RBPs) play important roles in mRNA transcription, processing, and translation.

이 논문을 인용하기

↓ .bib ↓ .ris
APA Lindsey GL, Hockley TK, et al. (2026). Structural and mechanistic analysis of covalent ligands targeting the RNA-binding protein NONO.. Cell chemical biology, 33(2), 256-267.e11. https://doi.org/10.1016/j.chembiol.2025.12.010
MLA Lindsey GL, et al.. "Structural and mechanistic analysis of covalent ligands targeting the RNA-binding protein NONO.." Cell chemical biology, vol. 33, no. 2, 2026, pp. 256-267.e11.
PMID 41534524 ↗

Abstract

RNA-binding proteins (RBPs) play important roles in mRNA transcription, processing, and translation. Chemical tools are lacking for RBPs, which has hindered efforts to perturb and understand RBP function in cells. We previously described a chloroacetamide compound (R)-SKBG-1 that covalently binds the RBP NONO and stabilizes its interactions with mRNAs, leading to transcriptional remodeling and suppression of cancer cell growth. Here, we report the crystal structure of an (R)-SKBG-1:NONO complex, which confirms covalent modification of cysteine-145 at a pocket proximal to the RNA-binding interface of the protein. We show that this pocket can also be targeted by a lower reactivity chlorofluoroacetamide analog (R, R)-GL-373, which retains the pharmacological properties of (R)-SKBG-1, including blockade of estrogen receptor expression in breast cancer cells, while displaying much greater proteome-wide selectivity. Our findings thus show that NONO can be targeted by covalent ligands with high specificity to pharmacologically suppress pro-tumorigenic gene products in cancer cells.

🏷️ 키워드 / MeSH 📖 같은 키워드 OA만

📖 전문 본문 읽기 PMC JATS · ~98 KB · 영문

INTRODUCTION

INTRODUCTION
The human genome encodes a broad array of RNA-binding proteins (RBPs) that regulate the processing, maturation, and function of diverse RNA components of the cell. Major roles for RBPs include the splicing,1 post-transcriptional modification,2 and translational control of messenger RNAs (mRNAs),3 the folding and assembly of ribosomal RNA (rRNA)-protein complexes,4 and the processing of small nuclear RNAs (snRNAs).5
Genetic mutations in RBPs cause many human diseases, underscoring the importance of this protein class for supporting cellular and organismal physiology.6,7 RBPs also have the potential to serve as drug targets for restoring human health through, for instance, the post-transcriptional regulation of pathogenic or beneficial gene products. In a compelling proof of principle, the small-molecule drug risdiplam stabilizes binding of the U1 small nuclear ribonucleoprotein (snRNP) complex to weak 5′ splice sites to promote exon inclusion and expression of the SMN2 gene to treat spinal muscular atrophy (SMA) caused by deleterious mutations in the related SMN1 gene.8 Nonetheless, realizing the broader therapeutic potential of RBPs depends on the identification of chemical probes for additional members of this large protein class, a goal that has been hindered by the limited availability of functional assays for RBPs9,10 and their perceived poor general druggability.11,12
We recently discovered by integrated phenotypic screening and activity-based protein profiling (ABPP) a series of electrophilic α-chloroacetamide (CA) compounds that covalently bind the RBP NONO to transcriptionally remodel and impair the growth of human cancer cells.13 NONO is a member of the Drosophila behavior/human splicing (DBHS) family of RBPs that includes the paralogs PSPC1 and SFPQ.14,15 These abundant nuclear proteins form hetero- and homo-dimers to regulate various stages of mRNA processing, transport, maturation, and stability.14,15 The lead compound (R)-SKBG-1 was found to engage a paralog-restricted cysteine (C145) located in a hinge region between the RRM1 and RRM2 RNA-binding domains of NONO,16–18 and mechanistic studies supported a model where (R)-SKBG-1 stabilizes NONO binding to mRNAs, including transcripts encoding the androgen receptor and its major splice variants, leading to decreases in their expression in cancer cells.13 Consistent with a gain-of-toxic function mechanism that cannot be overcome by the compensatory action of PSPC1 and SFPQ, the pharmacological effects of (R)-SKBG-1 were abrogated in cancer cells genetically disrupted for NONO.13
RRM domains are a common RNA-binding structure found in eukaryote proteomes that typically consists of a four-stranded β-sheet from which a series of conserved aromatic residues protrude.19 The RRM1 domain of DBHS proteins contains this canonical RNA-binding platform, while the RRM2 domain lacks several of the canonical aromatic residues.16 The arrangement of the RRM1 and RRM2 domains within the quaternary structure of DBHS proteins suggests an atypical mode of RNA binding, involving canonical interactions mediated by RRM1 combined with additional contributions from loops within RRM2. Although the RNA-binding site of NONO has not yet been determined by high-resolution structural biology, small-angle X-ray experiments have shown that the canonical RRM1 domain and part of the unusual RRM2 domain from the partner protomer of the dimer are both involved in interacting with RNA, and that RRM1 swings closer to RRM2 when nucleic acid is bound.18 Further insights can be gained from the structure of the NONO paralog SFPQ bound to RNA.20 The core region of both proteins share about 70% sequence identity, and the residues involved in contacting RNA are exceptionally well conserved. These conserved residues (allowing for Arg <-> Lys substitution and using NONO numbering) are as follows: from the RRM1 domain—four Phe residues (F77, F104, F111, and F113) and four basic/polar residues (N80, K137, R140, and R142); and from the NOPS domain of the same protomer—one basic residue (K243) – and from the RRM2 domain of the second protomer—two basic residues (R184 and R186)—which together form a “lid”. In SFPQ, an additional contact to a base is made by a non-conserved threonine residue, which is aligned with C145 in NONO (the cysteine that is covalently modified by (R)-SKBG-1).
While (R)-SKBG-1 has provided a valuable initial tool compound for studying NONO function in cells, our understanding of the structural basis for (R)-SKGB-1-NONO interactions remains limited. Additionally, (R)-SKBG-1 covalently modified many other proteins in cancer cells and showed only a narrow window of stereoselective antiproliferative effects compared to the inactive enantiomeric control compound (S)-SKBG-1. These deficiencies likely relate, at least in part, to the high intrinsic reactivity of the CA-reactive group of (R)-SKBG-1. Here, we report the X-ray crystal structure of a (R)-SKBG-1:NONO complex, which revealed a pocket supporting stereoselective reactivity at C145 that is proximal to the predicted RNA-binding interface of NONO. We concurrently discover that NONO can be targeted by an analog of (R)-SKBG-1 bearing a lower reactivity chlorofluoroacetamide (CFA) group. This CFA analog (R, R)-GL-373 displays stereoselective and NONO-dependent transcriptional remodeling and anti-proliferative activity, while exhibiting much greater proteome-wide selectivity compared to (R)-SKBG-1. Among the transcripts suppressed by (R, R)-GL-373 in breast cancer cells was the estrogen receptor (ESR1) mRNA, and we verified near complete loss of ESR1 protein by 24 h post treatment with (R, R)-GL-373. Our findings, taken together, support the presence of a druggable and functional pocket in NONO that can be targeted by low-reactivity electrophilic compounds to control pro-tumorigenic transcriptional pathways in cancer cells.

RESULTS

RESULTS

(R)-SKBG-1-NONO co-crystal structure
We expressed and purified the structured regions of the human NONO homodimer (residues 53–312), NONO/SFPQ heterodimer, and SFPQ homodimer from E. coli as previously reported.21–23 We then treated purified NONO homodimeric protein (125 μM) with (R)-SKBG-1 (4-fold molar excess, 15 min) prior to crystallization. The X-ray crystal structure of the (R)-SKBG-1:NONO complex was solved at 2.5 Å resolution and has two NONO homodimers in the asymmetric unit (Figure 1A; Table S1). Clear electron density was observed for the (R)-SKBG-1 compound with a covalent adduct to C145 (in mFo-DFc, 3.0 σ omit maps) in each of the four protomers. The sites in chain A and chain B allowed building of the complete (R)-SKBG-1 adduct, with chain A having the best-defined electron density, albeit with evidence of dynamic disorder around the sulfonamide-linked methoxyphenyl group (Figure S1A). The structure provided a rationale for the stereoselective reactivity of (R)-SKBG-1 with C145, as there is a hydrogen bond between the backbone nitrogen of this residue and the carbonyl group adjacent to the (R)-SKBG-1 stereocenter (2.9 Å; Figure 1B). This hydrogen bond interaction would not be possible with the (S)-SKBG-1 enantiomer. Additional contacts that may contribute to orienting (R)-SKBG-1 for reaction include a hydrogen bond of the acetamide with Q229 (3.4 Å) and stacking of the phenoxy substituent with the guanidinium moiety of R75 (Figure 1B). The previously reported apo-NONO homodimer structure (PDB 5IFM)18 showed structural variability across its six homodimers (RMSD 0.6 Å), which is elevated in the (R)-SKBG-1:NONO complex (RMSD 0.8–1.1 Å) due to subtle displacements of helices and loops in the coiled-coil and NOPS domains. These differences are, however, within the range observed for different crystal packing environments of the respective structures (Figure S1B).
We previously found using enhanced UV crosslinking and immunoprecipitation followed by sequencing (eCLIP-seq)24 that (R)-SKBG-1 stabilizes NONO binding to mRNAs in cells. Here, we evaluated the impact of (R)-SKBG-1 on purified NONO interactions with two GU-rich RNA oligonucleotides by microscale thermophoresis (MST). These experiments revealed that (R)-SKBG-1, but not the inactive enantiomer (S)-SKBG-1, increased the affinity of the NONO homodimer or NONO:SFPQ heterodimer for single-stranded RNA (Figures 1C, S1C, and S1D). In contrast, (R)-SKBG-1 did not alter the RNA affinity of an SFPQ homodimer (Figure 1C), as expected.
Alignment of the (R)-SKBG-1:NONO complex structure with an RNA-bound structure of the SFPQ homodimer (PDB: 7UJ1)20 revealed that (R)-SKBG-1 occupies a site overlapping with RNA in the SFPQ structure (Figure 1D), with the aromatic groups of (R)-SKBG-1 proximal to the sidechains of conserved phenylalanine residues (F77 and F113) in the RRM1 domain of NONO that are implicated in RNA-binding20,25 (Figure 1B). Considering that our biochemical and cell biological studies indicate (R)-SKBG-1 stabilizes rather than disrupts NONO-RNA interactions, we speculate that during RNA-binding, the aromatic groups of (R)-SKBG-1 adopt a different conformation to that observed in the crystal structure. This would serve to simultaneously free up RRM1 for “canonical” RNA-binding, and position (R)-SKBG-1 for additional productive interactions with RNA to result in the increased binding affinity that we observed by MST. The conformational flexibility of the (R)-SKBG-1 adduct is evidenced by the relatively weaker electron density observed around the aromatic groups. Given the proximity of C145 to the “lid” residues of the RRM2 and NOPS domains described for the SFPQ-RNA ternary structure,20 it is tempting to speculate that the (R)-SKBG-1 adduct serves as an additional large non-canonical lid residue, where the aromatic groups provide additional stacking contacts for RNA.

Chlorofluoroacetamides engage NONO with improved proteome-wide selectivity
While original CA ligands such as (R)-SKBG-1 engage NONO_C145 with excellent stereoselectivity, the broader proteomic reactivity of these compounds is high,13 which limits their utility in some types of cell biology experiments. In considering alternative approaches to covalently engage NONO with less reactive electrophiles, we noted that the hydrogen bond between the backbone N-H of C145 and the C2-carboxamide carbonyl of (R)-SKBG-1, and between the sidechain of Q229 and the CA carbonyl of (R)-SKBG-1 (Figure 1B), together positioned the electrophilic α-carbon center of this compound for reactivity with C145. We accordingly inferred that substitution of the CA group with lower reactivity β-carbon electrophiles like an acrylamide or butynamide might create compounds that are misaligned for covalent engagement of NONO_C145. As an alternative, we considered analogs bearing a CFA, which closely mimics the CA geometry while exhibiting much lower electrophilicity and has emerged as an attractive reactive group for the design of covalent ligands with improved selectivity.26–28
A full set of CFA stereoisomeric analogs of (R)- and (S)-SKBG-1 was synthesized (Figure 2A, and Data S1) and evaluated for reactivity with NONO by cysteine-directed ABPP32–35 in the prostate cancer cell line 22Rv1 (20 μM compound, 6 h). Of the four CFA analogs, a single stereoisomer (R, R)-GL-373 showed robust engagement of NONO_C145 (Figure 2B and Data S2). The inactivity of (S, R)-GL-373 indicated that the stereoconfiguration at the CFA center was crucial for reactivity with NONO_C145, as has been observed for CFA ligands targeting other proteins (e.g., SARS-CoV2 protease27). We next generated alkyne analogs of (R, R)- and (S, S)-GL-373—(R, R)- and (S, S)-GL-586, respectively (Figure 2A)—and evaluated the reactivity of these compounds by gel-ABPP in 22Rv1 cells stably expressing WT-NONO or a C145S-NONO mutant. These experiments showed clear stereoselective and site-specific reactivity of (R, R)-586 with WT-NONO with only a handful of additional protein reactivity events being observed across the gel profile (Figure 2C). The (R, R)-GL-586-WT-NONO interaction was blocked by pre-treatment with (R, R)-GL-373 (20 μM, 6 h), but not by other CFA stereoisomers (Figure 2D). Using this competitive gel-ABPP assay, we determined half-maximal target engagement (TE50) values for NONO of 2.2 and 9.0 μM for (R)-SKBG-1 and (R, R)-GL-373, respectively (Figure 2E). We also noted that (R, R)-GL-373 produced a partial stereoselective blockade of a strong ~55 kDa signal (Figure 2D) found in both WT-NONO or a C145S-NONO-expressing 22Rv1 cells (Figure 2C), as well as in cells genetically disrupted for NONO (sgNONO cells; Figure S2). We speculate that this signal corresponds to a combination of endogenous NONO and an additional target of the (R, R)-GL-586 probe.
Despite a modest (~4-fold) reduction in potency, the CFA ligands displayed much better proteome-wide selectivity compared to CA ligands as determined by gel-ABPP experiments performed with (R, R)-GL-586 versus an alkyne analog of (R)-SKBG-1 (compound 14;13
Figure 3A) and cysteine-directed ABPP experiments assessing the global reactivity of (R, R)-GL-373 and (R)-SKBG-1 (Figure 3B and Data S2). In the gel-ABPP experiments, the highest concentration tested for (R, R)-GL-586 (20 μM) produced much lower proteome-wide reactivity than the lowest concentration tested for 14 (5 μM) (Figure 3A). In the cysteine-directed ABPP experiments, (R, R)-GL-373 showed strong engagement (>75% blockade of iodoacetamide-desthiobiotin [IA-DTB] reactivity) of only three cysteines (NONO_C145, FAM213_C83/85, and USP48_C409), while (R)-SKBG-1 engaged >20 additional cysteines (Figure 3B and Data S2). The lower proteomic reactivity of the CFA-based NONO ligands correlated with decreased glutathione reactivity compared to CA compounds (Table S2).
We also verified stereoselective engagement of NONO by CFA ligands in a second human cancer cell line—the hormone-sensitive breast cancer line MCF7. In these experiments, we compared the time-dependent engagement of NONO by (R)-SKBG-1 and (R, R)-GL-373 by protein-directed ABPP32 using (R, R)-GL-586 as the enrichment probe, which revealed that, while (R)-SKBG-1 engaged NONO more rapidly than (R, R)-GL-373 (2 h time point, Figure 3C and Data S2), both compounds near-completely engaged NONO at later time points, and this engagement was sustained for at least 24 h (Figure 3C and Data S2), consistent with the long half-life reported previously for NONO (>50 h).36 The protein-directed ABPP experiments additionally verified stereoselective engagement of NONO by (R, R)-GL-373 (in comparison to (S, S)-GL-373; Figures 3C–3E and Data S2) along with a handful of additional off-targets (Figure 3D). Interestingly, unlike NONO (Figure 3E), most of these off-targets were strongly engaged by both (R)-SKBG-1 and (S)-SKBG-1 (Figure 3F), suggesting that the reduced intrinsic electrophilicity of the CFA group, while substantially lowering overall proteomic reactivity, might paradoxically enhance the stereoselective liganding of a subset of proteins that are more indiscriminately engaged by higher reactivity CA compounds.
Our data, taken together, demonstrate that NONO_C145 can be stereoselectively and site-specifically engaged by CFA ligands, and these compounds show much lower proteome-wide reactivity in cells than original CA ligands. We next compared the biological effects of (R, R)-GL-373 and (R)-SKBG-1 in cancer cells.

(R, R)-GL-373 exhibits NONO-restricted transcriptomic and growth effects in cancer cells
We previously found that (R)-SKBG-1 remodeled the transcriptomes of cancer cells, and this effect was largely stereoselective (most of the changing genes were not affected by (S)-SKBG-1) and NONO-dependent (most of the changing genes were not affected by (R)-SKBG1 in sgNONO cells).13 Here, we evaluated the transcriptomic effects of (R, R)- and (S, S)-GL-373 (20 μM, 6 h) in MCF7 cells by RNA-sequencing (RNA-seq) and found that (R, R)-GL-373 produced profound effects on the MCF7 transcriptome that included substantial (log2 > 1) decreases in nearly 1,000 genes and a more restricted increase in ~60 genes (Figures 4A and S3, and Data S3). These effects were stereoselective (Figures 4B and S4A and Data S3) and generally not observed in sgNONO cells (Figures 4C, S4B, and S4C, and Data S3). Additionally, the NONO-dependent transcriptomic effects of (R, R)-GL-373 generally aligned with those of (R)-SKBG-1 (5 μM, 6 h) (Figure 4D and Data S3) with the exception of a limited subset of genes that were strongly induced by (R)-SKBG-1, but not (R, R)-GL-373 (Figure 4E). These genes were also induced by (i) (S)-SKBG-1 and (ii) (R)-SKBG-1 in sgNONO cells (Figure 4E, right; Figures S4D and S4E), suggesting they were NONO-independent effects. We noted that several of the genes induced by (R)-SKBG-1, but not (R, R)-GL-373, are also regulated by the KEAP1-NRF2 electrophilic/oxidative stress response pathway.37–39 We interpret these data to indicate that (R, R)-GL-373 causes much less electrophilic stress compared to (R)-SKBG-1 and, as a consequence, produces a more NONO-restricted impact on cancer cell transcriptomes.
The transcriptomic effects of (R, R)-GL-373 included the downregulation of several cancer-relevant genes, including those encoding the transcription factors ESR1, RXRA, and TRPS1 (Figures 4A–4C). (R, R)-GL-373 also increased the expression of the NONO paralog PSPC1 (Figures 4A, 4B, and 4E), an effect that is also observed in cells genetically disrupted for NONO13,40 (and has been proposed to reflect a compensatory response to loss of NONO).15,40 Western blotting experiments performed at 24 h post-treatment confirmed that (R, R)-GL-373 additionally induced stereoselective and NONO-dependent decreases in the abundance of ESR1 and RXRA proteins, as well as increases in PSPC1 (Figures 4F and 4G). These effects were observed across a concentration range of 5–20 μM of (R, R)-GL-373 with near complete loss of ESR1 in MCF7 cells treated with 10 μM (Figure 4F).
Finally, both (R)-SKBG-1 and (R, R)-GL-373 produced stereoselective and NONO-dependent reductions in the proliferation of MCF7 cells (Figure 4H). While (R)-SKBG-1 showed higher potency than (R, R)-GL-373 in these cell growth assays, the anti-proliferative effects of (R, R)-GL-373 showed much greater stereoselectivity and NONO-dependency, likely reflecting the lower general electrophilic stress caused by this compound compared to (R)-SKBG-1.
These data, taken together, indicate that CFA ligands exhibit NONO-dependent effects on the transcriptomes and growth of cancer cells while avoiding the NONO-independent electrophilic stress caused by original CA ligands.

DISCUSSION

DISCUSSION
RBPs represent an exciting opportunity for chemical biology and drug discovery.11,12 A substantial portion of the human proteome binds RNA as a primary or secondary function,2,41 and many RBPs have clear human-disease relevance.42 Additionally, drugs such as risdiplam for the treatment of SMA have shown the potential for RBPs to serve as targets that promote therapeutic gene expression.8 Nonetheless, most RBPs lack chemical probes, likely reflecting, at least in part, the technical challenges associated with screening this class of proteins, which are often parts of large and dynamic complexes. ABPP and related chemical proteomic methods offer an attractive way to identify ligands for RBPs directly in native cellular environments, as we recently demonstrated with the discovery of CAs that covalently bind NONO to remodel the transcriptomes of cancer cells.13 However, the structural bases for CA binding to NONO, as well as the potential to advance this interaction into more selective chemical probes, have remained important open questions.
The (R)-SKBG-1-NONO co-crystal structure provides clear evidence of a small molecule-binding pocket proximal to the RRM1 and RRM2 RNA-binding domains. Our biochemical data measuring NONO binding affinity for RNAs also support previous cell-based (eCLIP) experiments13 that covalent binding of (R)-SKBG-1 to this pocket enhances NONO-RNA interactions. How precisely this outcome is achieved remains unclear. Limited structural information is available on DBHS protein-RNA complexes, and the only available structure of RNA-bound SFPQ homo-dimers20 would suggest that (R)-SKBG-1 might disrupt NONO-RNA interactions. On the other hand, the various structures of DBHS proteins show highest variability in the pose of the RRM1 domain,15 and it is possible that (R)-SKBG-1 reactivity with C145 strengthens RNA binding to NONO by resembling a productive conformation for RNA interactions. A structure of a ternary covalent ligand:NONO:RNA complex may be required to more fully understand how small molecule reactivity with C145 strengthens NONO-RNA interactions.
The (R)-SKBG-1-NONO structure also revealed a well-aligned binding pose for C145 reactivity with the CA α-carbon of (R)-SKBG-1, which inspired the generation of a less electrophilic CFA analog (R, R)-GL-373. While (R, R)-GL-373 showed some loss (~4-fold) in potency for engaging NONO, the much greater proteome-wide selectivity of this interaction resulted in profound NONO-dependent remodeling of breast cancer cell transcriptomes without the induction of general electrophile stress caused by (R)-SKBG-1. These data thus provide further evidence for the utility of the CFA as a tempered reactive group in the development of covalent chemical probes.26–28,43 We should acknowledge, however, that the cellular activity of (R, R)-GL-373 likely benefited from the long half-life of NONO, which allowed for near-complete and sustained engagement of C145 over a 24 h time period (Figure 3C). Shorter half-life proteins may require higher potency CFA compounds to achieve similar levels of engagement in cells. (R, R)-GL-373 also exhibited stereoselective reactivity with a handful of proteins beyond NONO, which reinforces the importance of performing additional control experiments in NONO-disrupted (sgNONO) cells to verify on-target (NONO dependent) activities, as we demonstrated herein for the transcriptomic and cell growth effects of (R, R)-GL-373.
Looking forward, we are intrigued by the impact of covalent NONO ligands on the expression of breast cancer-relevant transcription factors like ESR1 and TRPS1, which mirror the previously reported effects of NONO ligands on androgen receptor expression in prostate cancer cells.13 From a translational perspective, these findings suggest that targeting NONO may offer a way to suppress lineage drivers in breast and prostate cancer that is complementary to the targeted protein degradation strategies under investigation in the clinic.44,45 However, the current NONO ligands, including (R, R)-GL-373, suppress a large swath of transcripts, which results in a more general antiproliferative effect.13 Using the (R)-SKBG-1-NONO co-crystal structure as a guide, we speculate that it may be possible to develop ligands with improved transcript selectivity by, for instance, modifying the structures of these compounds to interface more directly with RNA. Finally, we also anticipate that the tempered reactivity and greater proteomic specificity displayed by (R, R)-GL-373 will facilitate addressing fundamental mechanistic questions that include the following: (1) how do NONO ligands promote such a rapid loss of transcripts in cancer cells? (2) What features do these transcripts share in common that confer sensitivity to NONO ligands? (3) How do cells exposed to NONO ligands upregulate paralogous DBHS proteins? (4) What cellular factors confer sensitivity or resistance to NONO ligands? Considering the diverse transcriptional and post-transcriptional roles performed by DBHS proteins in human cells, we believe the development of (R, R)-GL-373 will serve as a useful tool for studying the functions of this important family of RBPs.

Limitations of the study
Given that our (R)-SKBG1:NONO co-crystal structure lacks RNA, we can only speculate, at this stage, on how covalent ligands strengthen NONO interactions with RNA. While our MST experiments support that (R)-SKBG-1 increases NONO-binding affinity for multiple RNAs, the precise structural mechanism underlying this outcome remains poorly defined. Specifically, how ligands reacting with C145 of NONO influence conformational dynamics within the RRM1 domain and strengthen the NONO-RNA interface has yet to be resolved. Future efforts to determine a ternary ligand:NONO:RNA structure hold promise to provide more detailed mechanistic insights.
Despite exhibiting substantial improvements in proteome-wide selectivity, CFA ligands, such as (R, R)-GL-373, still show only low-μM engagement of NONO. While this degree of potency does not hinder the use of (R, R)-GL-373 in cell biological studies, improvements will be needed before such CFA ligands can be applied to study NONO function in vivo. From a translational perspective, covalent NONO ligands suppress the expression of key cancer drug targets like ESR1, but this effect is also accompanied by decreases in a large array of other transcripts that will likely limit the cell type-specificity of the antiproliferative activity of NONO ligands. Whether NONO ligands can be optimized to show transcript-restricted activity remains an important unanswered question.

RESOURCE AVAILABILITY

RESOURCE AVAILABILITY

Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contacts, Benjamin F. Cravatt (cravatt@scripps.edu) and Charles S. Bond (charles.bond@uwa. edu.au).

Materials availability
All chemical probes and other elaborated electrophilic compounds generated in this study are available from the lead contact with a completed materials transfer agreement.

Data and code availability
Crystallographic data have been deposited at the Protein DataBank and are publicly available as of the date of publication. The PDB accession number is PDB: 9NZI and is listed in the key resources table. Proteomics data have been deposited at PRIDE and are publicly available as of the date of publication. The dataset identifier is PRIDE: PXD064685 and is listed in the key resources table. Processed proteomics data are provided in Data S2. RNA-seq data have been deposited at the NCBI Gene Expression Omnibus (GEO) and are publicly available as of the date of publication. The accession number is GEO: GSE299099 and is listed in the key resources table. Processed RNA-seq data are provided in Data S3. All other data reported in this study are available from the lead contact upon request.

This article does not report original code.

Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.

STAR★METHODS

STAR★METHODS

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Cell lines
22Rv1 (CVCL_1045, Male, Prostate carcinoma) and MCF7 (CVCL_0031, Female, Breast adenocarcinoma) cells were obtained from ATCC and grown and maintained in RPMI 1640 media (Thermo Fisher Scientific) containing 10% (v/v) FBS (Omega Scientific), 100 U/mL penicillin-streptomycin (GE Life Sciences), and Glutamax [22Rv1] or DMEM (Thermo Fisher Scientific) containing 10% (v/v) FBS (Omega Scientific), Glutamax, and 100 U/mL penicillin-streptomycin (GE Life Sciences) [MCF7] at 37°C with 5% CO2. All cell lines were obtained directly from ATCC, were not further authenticated after purchase, and were routinely inspected for mycoplasma contamination.

METHOD DETAILS

Crystallography
Truncated versions of NONO (residues 53–312) homodimer, SFPQ (276–535) homodimer and NONO/SFPQ heterodimer were expressed, purified and concentrated for crystallography and microscale thermophoresis (MST) experiments as described.21–23
For crystallization, NONO homodimer (3.7 mg/mL) was incubated with 4x molar excess of (R)-SKBG-1 (100 μM in DMSO) for 15 min at room temperature. Sitting drop vapor diffusion screens (ProPlex Screen MD1–38, SG1 Screen MD1–88, Pact Premier, JGSG Plus (Molecular Dimensions), Natrix 1 & 2 (Hampton Research) were set up in Intelli-Plate 96–3 (Art Robbins) plates using an Art Robbins Phenix liquid handling robot (reservoir 80 μL, protein:reservoir ratios 1:1, 2:1, 1:2), incubated at 20°C and observed using Formulatrix RockImager. Diffraction quality crystals were obtained from conditions optimized to 0.1 M HEPES, 28% PEG 2000 monomethyl ether. Crystals were cryoprotected by addition of 10% glycerol, harvested and cryopreserved for data collection at the MX2 beamline of the Australian Synchrotron.46 Complete data to 2.5 Å, reduced with XDS47 yielded a dataset suitable for structure solution and refinement (details in Table S1). The structure was solved by molecular replacement (MOLREP),48 CCP4 Suite49 using a NONO homodimer model derived from chains A and B of PDB entry 5IFM.18 Subsequent rounds of model fitting, refinement and validation in COOT50 and PHENIX,51 including geometric parameters for the C145-linked SKBG-1 (ELBOW),52 yielded a final model with two NONO homodimers in the asymmetric unit and an R factor of 22.5% and R-free of 26.2%. The validated structure was deposited in the PDB with code 9NZI.

Microscale thermophoresis assay (MST)
For MST experiments, RNA oligonucleotides (5′–6 FAM–TGUGUGUGGCCGU–3′ and 5′–6 FAM–TUGUGCCGUCU–3′) were purchased from IDT. NONO homodimer, SFPQ homodimer and NONO/SFPQ heterodimer were incubated with a 4x excess (per protein monomer) of (-R)-SKBG-1 (100 μM in DMSO), (S)-SKBG-1 or DMSO only. MST was carried out in triplicate on a dilution series of protein in the presence of 200 nM RNA using a Monolith NT.155 instrument, and data analyzed using MO. Affinity (NanoTemper). To test the significance of order of addition of SKBG-1 and RNA, measurements were carried out on series of simples of identical composition, but with RNA added first.

Plasmid amplification and purification
All plasmids were amplified in Stbl3 cells (ThermoFisher) using vendor’s procedures and purified by miniprep (QIAGEN), except for the pRK5 and pLenti6.2-ccdB-3xFLAG-V5 Gateway destination vectors, which were amplified in ccdB Survival T1 cells (Invitrogen).

Mutagenesis
Site-directed mutagenesis was performed on the pDONR 223-NONO construct from the Human ORFome V8.1 Library (Dharmacon) using the Quikchange mutagenesis kit (Agilent). All mutations were verified by DNA sequencing. Primers for mutagenesis (mutated nucleotide in bold and underlined).
NONO-C145S-fwd (T→A): GTGTGCGCTTTGCCAGCCATAGTGCATCC

NONO-C145S-rev: GATGCACTATGGCTGGCAAAGCGCACAC

NONO-PAM-mutation-fwd (C→G): ACCAGGAGAGAAGACGTTCACCCAACGAAGC

NONO-PAM-mutation-rev: GCTTCGTTGGGTGAACGTCTTCTCTCCTGGT

NONO-gateway-STOP-fwd (C→A): CAAACAAACGTCGCCGATACTAACCAACTTTCTTGTACAAAG

NONO-gateway-STOP-rev: CTTTGTACAAGAAAGTTGGTTAGTATCGGCGACGTTTGTTTG

Plasmids for stable expression
The desired pDONR 223-NONO construct was cloned into pLenti6.2-ccdB-3xFLAG-V5 (Addgene #87071) using the gateway vector conversion system (Invitrogen). Final plasmids contain a CMV promoter followed by a Gateway cloning linker, a start methionine, the NONO ORF without stop codon, a C-terminal FLAG tag, and a second Gateway cloning linker. All gene constructs were verified by DNA sequencing.

NONO knockout by CRISPR/Cas9
NONO knockout cells were generated using previously described protocols.53 In brief, non-targeting control sgRNAs or sgRNAs targeting NONO (described below) were designed (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design), and cloned into Lenti-CRISPR v2 plasmid (Addgene). 1 μg sgRNA-encoding plasmids were co-transfected with ΔVPR envelope (0.9 μg) and CMV VSV-G (0.1 μg) packaging plasmids into 2.5 × 106 HEK293T cells using the Fugene 6 transfection reagent (Promega). Virus-containing supernatants were collected forty-eight hours after transfection, passed through a 0.45 μM filter, and used to infect target cells in the presence of 10 μg/mL polybrene (Santa Cruz). Twenty-four hours post-infection, fresh media was added to the target cells, which were allowed to recover for an additional twenty-four hours. Puromycin (1 μg/mL) was then added to cells Following 10 days of puromycin selection, NONO expression in NONO sgRNA cells was determined by Western blot (see STAR Methods below) compared to control sgRNA transfected cells.
Non-targeting sgRNA (sequences are 5′–3′).
Lenti-CRISPRv2: sgCRISPR-CTRL1-fwd: GCGAGGTATTCGGCTCCGCG

Lenti-CRISPRv2: sgCRISPR-CTRL1-rev: CGCGGAGCCGAATACCTCGC

sgRNAs targeting NONO (sequences are 5′–3′).
Lenti-CRISPRv2: NONO-1-fwd: CTGGACAATATGCCACTCCG

Lenti-CRISPRv2: NONO-1-rev: CGGAGTGGCATATTGTCCAG

Generation of 22Rv1 NONO C-FLAG WT or C145S cell line
1 μg pLenti6.2-NONO-C-FLAG-encoding plasmid (WT or C145S) with a silent PAM site mutation was co-transfected with ΔVPR envelope (0.9 μg) and CMV VSV-G (0.1 μg) packaging plasmids into 2.5 × 106 HEK293T cells using the Fugene 6 transfection reagent (Promega). Virus-containing supernatants were collected forty-eight hours after transfection, passed through a 0.45 μM filter, and used to infect target cells in the presence of 10 μg/mL polybrene (Santa Cruz). Twenty-four hours post-infection, fresh media was added to the target cells, which were allowed to recover for an additional twenty-four hours. Blasticidin (10 μg/mL) was then added to cells. Following 10 days of blasticidin selection, NONO-FLAG expression was determined by Western blot (see STAR Methods below) compared to empty vector transfected cells. Endogenous NONO was then knocked out by CRISPR/Cas9 using NONO sgRNA as described above.

Western blot analysis
For western blot protein analysis, cells (5 × 105 cells/treatment) were seeded in 2 mL media in a 6 well plate for 24 h. Media was then aspirated and replaced with 2 mL media containing the indicated compounds or 0.1% DMSO for the indicated times. Following this incubation period, the cells were washed in cold DPBS, scraped, harvested and pelleted in 1.5 mL tubes (2000 g, 3 min, 4°C). Cell pellets were flash-frozen in liquid N2 and stored at −80°C until further analysis. On the day of the analysis, the cell pellets were thawed on ice, re-suspended in cold PBS (100–150 μL), and lysed by sonication using a Branson Sonifier SFX250 (Branson Ultrasonics, catalog #101-063-965). Sonication was performed with a microtip probe at 10% amplitude, using pulsed mode (1 s on/1 s off) for 2 cycles of 8 pulses each, while samples were kept on ice. Protein concentrations for all the samples were measured by BCA assay (ThermoFisher) and adjusted to 2 mg/mL, 4x loading buffer was added, and the samples were heated at 95°C for 5 min, followed by a 1 min spin at 20,000g. The proteins were resolved using SDS-PAGE (10% acrylamide gel) and transferred to 0.2 μm Power Blotter Select Transfer Stacks, nitrocellulose, mini (invitrogen). The membrane was blocked with 5% milk in Tris-buffered saline (20 mM Tris-HCl 7.6, 150 mM NaCl) with 0.1% tween 20 (TBST) buffer at RT for 1 h or at 4°C overnight), washed with TBST, and incubated with primary antibodies in 5% milk in TBST at 4°C overnight (at 1:10000, 1:5000, or 1:2000 depending on the antibody). Following another TBST wash (3 × 3 min), the membrane was incubated with secondary antibody (1:1000 in 5% milk in TBST) at RT for 1 h. The membrane was washed with TBST (3 × 3 min), developed with Femto (for RXRA, ESR1, or PSPC1) or standard (for NONO, FLAG, and GAPDH) ECL western blotting detection reagent kit (Thermo Scientific), and chemiluminescence was imaged on a ChemiDoc MP system (Bio-Rad). Relative band intensities were quantified using Image Lab software (Biorad).

Gel-based ABPP
5 × 105 22Rv1 cells stably expressing 3X-FLAG-V5 (WT or C145S), were seeded into a 6 well plate and allowed to adhere overnight at 37°C. Once at 80–90% confluence, cells were then treated with DMSO (0.1%) or the indicated compound for 6 h in situ, followed by treatment with (R, R)-GL-586 or #14 alkyne at the indicated concentration (otherwise 10 μM) probe in situ for 1 h at 37°C. Following this incubation period, the cells were washed in cold DPBS, scraped, harvested and pelleted in 1.5 mL tubes (2000 g, 5 min, 4°C). Cell pellets were flash-frozen in liquid N2 and stored at −80°C until further analysis. On the day of the analysis, the cell pellets were thawed on ice, re-suspended in cold PBS (with Roche cOmplete, mini, EDTA-free Protease Inhibitor Cocktail, 1 tablet in 10 mL PBS) and lysed by sonication with Branson probe sonicator (2 × 15 pulses; 10% power output). Protein concentrations for all the samples were measured by BCA assay (Thermofischer) and adjusted to 2 mg/mL. Rhodamine-azide (1 μL/reaction, 1.25 mM in DMSO), CuSO4 (1 μL/reaction, 50 mM in H2O), TBTA (3 μL/reaction, 1.7 mM in DMSO/t-BuOH (1:4, v/v)) and tris(2-carboxyethyl) phosphine (TCEP) (1 μL/reaction, 50 mM in H2O, freshly prepared) were premixed. 6 μL of this click reagent mixture was immediately added to 50 μL of each alkyne probe-labeled sample and incubated for 1 h at room temperature. The reactions were quenched by adding 4X SDS–PAGE loading buffer. The quenched samples were loaded on a 10% acrylamide gel for separation by SDS-PAGE. Samples were visualized by in-gel fluorescence scanning using the ChemiDoc MP system (Bio-Rad) and fluorescent band intensity was quantified with Image Lab software (Bio-Rad).

Cysteine-directed ABPP
Cysteine-directed activity based-protein profiling (ABPP) was performed as previously described.32 22Rv1 cells (2 million cells in 10 cm dish) were plated and given time to adhere to the plate. Once plates were about 80–90% confluent the cells were treated with DMSO or indicated probes. Cells were washed with ice-cold DPBS (3x), followed by resuspension in DPBS and lysed by probe-sonication (2 × 15 pulses; 10% power output). The total protein content of whole-cell lysates was measured using a Pierce BCA protein assay kit and the samples were normalized to 2 mg/mL and 500 μL. Samples were treated with 5 μL of 10 mM IA-DTB (in DMSO) for 1 h at RT with vortexing every 20 min. Proteins were precipitated by the addition of cold methanol (600 μL), chloroform (200 μL) and HPLC-grade water (100 μL), followed by vortexing and centrifugation at 16,000×g for 10 min. Without disrupting the protein disk, both the top and bottom layers were aspirated, and the protein disk was sonicated again in 500 μL of methanol and centrifuged at 16,000×g for 10 min. After the methanol was completely aspirated, protein pellets were immediately processed or frozen at −80°C. Pellets were resuspended in 90 μL of denaturing/reducing buffer (9 M urea, 10 mM DTT, 50 mM triethylammonium bicarbonate (TEAB) pH 8.5). The samples were reduced by heating at 65°C for 20 min, followed by alkylation with 10 μL of 500 mM iodoacetamide at 37°C for 30 min. The samples were then centrifuged at 16,000×g for 2 min to pellet any insoluble precipitate and probe-sonicated once more to ensure complete resuspension, and then diluted with 300 μL of 50 mM TEAB pH 8.5 to reach a final urea concentration of 2 M. Trypsin (4 μL of 0.25 μg/μL in trypsin resuspension buffer with 25 mM CaCl2) was added to each sample and digested at 37°C overnight. Digested samples were then diluted with 300 μL of enrichment buffer (50 mM TEAB pH 8.5, 150 mM NaCl, 0.2% NP-40) containing streptavidin-agarose beads (50 μL of 50% slurry/sample) and were rotated at RT for 2 h. The samples were centrifuged (2,000×g, 2 min) and the entire content transferred to BioSpin columns and washed (3 × 1 mL wash buffer, 3 × 1 mL DPBS, 3 × 1 mL water). Enriched peptides were eluted from the beads with 300 μL of 50% acetonitrile with 0.1% formic acid and dried using a SpeedVac at 46°C. Enriched peptides were resuspended in 100 μL EPPS buffer (200 mM, pH 8.0) with 30% acetonitrile, vortexed and water bathsonicated. The samples were TMT-labelled by the addition of 3 μL of 20 mg/mL (in dry acetonitrile) of corresponding TMT10 plex tag for 1.5 h at RT with vortexing every 30 min. TMT labeling was quenched by the addition of hydroxylamine (3 μL 5% solution in H2O) and incubated for 15 min at RT. Samples were then acidified with 5 μL formic acid, combined and dried using a SpeedVac. Samples were desalted with a Sep-Pak column and then high-pH-fractionated by HPLC (described in the following section) into a 96-well plate and recombined into 12 fractions (total).

HPLC fractionation
Desalted samples were resuspended in 500 mL buffer A (5% acetonitrile, 0.1% formic acid in milliQ water) and fractionated with Agilent HPLC into a 96 deep-well plate containing 20 mL of 20% formic acid to acidify the eluting peptides, as previously reported.28 The peptides were eluted onto a capillary column (ZORBAX 300Extend-C18, 3.5 mm) and separated at a flow rate of 0.5 mL/min using the following gradient: 100% buffer A from 0 to 2 min, 0%–13% buffer B from 2 to 3 min, 13%–42% buffer B from 3 to 60 min, 42%–100% buffer B from 60 to 61 min, 100% buffer B from 61 to 65 min, 100%–0% buffer B from 65 to 66 min, 100% buffer A from 66 to 75 min, 0%–13% buffer B from 75 to 78 min, 13%–80% buffer B from 78 to 80 min, 80% buffer B from 80 to 85 min, 100% buffer A from 86 to 91 min, 0%–13% buffer B from 91 to 94 min, 13%–80% buffer B from 94 to 96 min, 80% buffer B from 96 to 101 min, and 80%–0% buffer B from 101 to 102 min (buffer A: 10 mM aqueous NH4HCO3; buffer B: acetonitrile). The plates were evaporated to dryness using SpeedVac and peptides resuspended in 80% acetonitrile, with 0.1% formic acid and combined to a total of 12 fractions (e.g., fraction1 = well 1A+ 1B.1H, fraction 2 = well 2A+2B.2H) (3 × 300 mL/column). Samples were SpeedVac to dryness and the resulting 12 fractions were re-suspended in buffer A (5% acetonitrile, 0.1% formic acid) and analyzed by mass spectrometry.

Protein-directed ABPP
Protein-directed ABPP was performed as previously described.32 MCF7 cells were treated with DMSO or an indicated concentration of compounds for 6 h (unless otherwise stated) followed by an alkyne probe (10 μM, 1 h). Cells were washed with ice-cold DPBS (3x). Cell pellets were resuspended in DPBS and lysed by probe-sonication (2 × 15 pulses; 10% power output). Proteome was normalized to 2 mg/mL in 500 mL (Pierce BCA protein assay), and the alkyne probe labeled proteins were treated with 55 μL of click MS-Master-mix [30 μL of 1.7 mM TBTA in 4:1 t-BuOH:DMSO, 10 μL of 50 mM CuSO4 in H2O, 10 μL of freshly prepared 50 mM Tris(2-carboxyethyl)phosphine in H2O, 10 μL of 10 mM Biotin-PEG4-azide]. Proteins were precipitated with cold methanol (600 μL), chloroform (200 μL) and water (100 μL), vortexed, and then centrifuged at 16,000×g for 10 min. The top and bottom layers were aspirated, and the protein-disk was washed with 1 mL ice-cold MeOH and the protein disk was then sonicated in 500 μL of ice-cold methanol and pelleted at 16,000×g for 10 min. After the methanol was completely aspirated, protein pellets were immediately processed or stored at −80°C. Pellets were resuspended in 500 μL freshly prepared 8 M urea in DPBS, followed by the addition of 10 μL of 10 wt % SDS. Samples were then pulse-sonicated until clear (~15 pulses). The samples were reduced with 25 μL of 200 mM dithiothreitol (DTT) at 65°C for 15 min, followed by alkylation with 25 μL of 400 mM iodoacetamide at 37°C for 30 min in the dark. Then, 65 μL of 20 wt % SDS was added, and the samples were transferred to a 15-mL tube in a total volume of 6 mL with DPBS (0.2% final SDS). Washed streptavidin beads (Thermo, #20353; 100 μL of 50% slurry/sample) were then added and proteins were enriched for 1.5 h at RT with rotation. After incubation, the beads were pelleted (2 min at 2,000×g) and washed with 0.2% wt % SDS in DPBS (2 × 10 mL), DPBS (1 × 5 mL), HPLC-grade water (2 × 1 mL) and 200 mM 4-(2- hydroxyethyl)-1-piperazinepropanesulfonic acid (EPPS; 1 mL, pH 8.0). Enriched proteins were digested on-bead overnight with 200 μL of trypsin mix (2 M urea, 1 mM CaCl2, 10 μg/mL trypsin (Promega, #V5111), 200 mM EPPS, pH 8.0). The beads were pelleted at 2,000×g, the supernatant was collected and then diluted with 100 μL acetonitrile (30% final). Samples were then labeled with 6 μL 20 mg/mL (in dry acetonitrile) TMTpro 16plex tag (Thermo, #A44520) or TMT10plex (Thermo, #90406) for 1.5 h at RT (vortexed every 30 min). TMT labeling was quenched by the addition of hydroxylamine (6 μL 5% solution in H2O) and incubated for 15 min at RT. Samples were then acidified with 20 μL formic acid, combined and dried using a SpeedVac at 46°C. Samples were desalted with a Sep-Pak column Vac 1 cc (50 mg) (Waters, #WAT054955) and then high pH fractionated into ten fractions using Pierce peptide desalting spin columns (Thermo, #89852) and an acetonitrile/NH4HCO3 (10 mM) gradient for high-pH spin column fractionation (described in the following section) and analyzed by mass spectrometry.

High-pH spin column fractionation
Thirty high-pH elution buffers were freshly prepared for peptide fractionation using increasing concentrations of acetonitrile (ACN) in 10 mM aqueous ammonium bicarbonate (NH4HCO3). Each eluent was prepared in low-bind microcentrifuge tubes by mixing the appropriate volumes of ACN and 10 mM NH4HCO3 to a final volume of 1 mL per fraction. The ACN concentrations ranged from 7.5% to 95%, increasing in 2.5% increments. For each sample, one high-pH reversed-phase spin column was equilibrated. To begin, the white bottom cap of the spin column was removed, and the red top cap was loosely tightened. The spin column was placed into a 2.0 mL microcentrifuge tube and centrifuged at 5,000×g for 2 min to pack the resin and remove the storage solution. Next, each column was washed twice with 300 μL of 100% acetonitrile (MeCN), centrifuging at 5,000×g for 2 min each time and discarding the flow-through. This was followed by two washes with 300 μL of water containing 0.1% formic acid, using the same centrifugation conditions. The column was then considered equilibrated. Dried, TMT-labeled peptide samples were resuspended in 300 μL of buffer A and loaded onto the equilibrated column. The sample was centrifuged at 2,000×g for 2 min, and the flow-through was collected, re-applied to the column, and centrifuged again at 2,000×g for 2 min to maximize peptide retention. The column was washed by transferring it to a fresh 2.0 mL microcentrifuge tube and adding 300 μL of water, followed by centrifugation at 2,000×g for 2 min. To remove excess TMT reagent, 300 μL of 5% MeCN in 10 mM aqueous ammonium bicarbonate (NH4HCO3) was added to the column, and the sample was centrifuged at 2,000×g for 2 min. Peptides were eluted into fresh 1.5 mL microcentrifuge tubes using the pre-prepared high-pH eluent mixtures (100 μL per fraction, 300 μL for the final elution), spinning at 2,000 × g for 1 min per elution. A total of 30 individual fractions were collected. Every 10th fraction was combined to yield 10 final pooled fractions (e.g., fractions 1, 11, and 21 were combined). Combined fractions were dried using a SpeedVac concentrator and analyzed by mass spectrometry.

TMT LC-MS analysis
Fractions were resuspended in buffer A (5% acetonitrile, 0.1% formic acid in water) and analyzed by liquid chromatography-tandem mass spectrometry using an Orbitrap Fusion Tribrid Mass Spectrometer (Thermo Scientific) coupled to an UltiMate 3000 Series Rapid Separation LC system and autosampler (Thermo Scientific Dionex). The peptides were eluted onto a capillary column (75-μm-inner-diameter fused silica, packed with C18 (Waters, Acquity BEH C18, 1.7 μm, 25 cm) or an EASY-Spray HPLC column (Thermo, #ES902, #ES903) using an Acclaim PepMap 100 (Thermo, #164535) loading column, and separated at a flow rate of 0.25 μL min-1. Peptides were separated across a 10 min gradient of 5%, 150 min gradient of 5–20%, 20 min 20–45%, and then 5 min 45–95% acetonitrile (0.1% formic acid) in H2O (0.1% formic acid) followed by column equilibration. Data were acquired using an MS3-based TMT method on Orbitrap Fusion or Eclipse Tribrid mass spectrometers.

Fusion instruments:
The scan sequence began with an MS1 master scan (Orbitrap analysis, resolution 120,000, 400–1,700 m/z, RF lens 60%, maximum injection time 50 ms) with dynamic exclusion enabled (repeat count 1, duration 15 s). The top precursors were then selected for MS2/MS3 analysis. MS2 analysis consisted of quadrupole isolation (isolation window 0.7) of precursor ion followed by collision-induced dissociation in the ion trap (collision energy 35%, maximum injection time 120 ms). Following the acquisition of each MS2 spectrum, synchronous precursor selection enabled the selection of up to 10 MS2 fragment ions for MS3 analysis. MS3 precursors were fragmented by higher energy collisional dissociation (HCD) and analyzed using the Orbitrap (collision energy 55, maximum injection time 120 ms, resolution 50,000). For MS3 analysis, we used charge state-dependent isolation windows. For charge state z = 2, the MS isolation window was set at 1.2; for z = 3–6 the MS isolation window was set at 0.7.

Eclipse Tribrid instrument:
The scan sequence began with an MS1 master scan (Orbitrap analysis, resolution 120,000, 400–1,700 m/z, RF lens 30%, maximum injection time 50 ms) with dynamic exclusion enabled (repeat count 1, duration 30 s). The top precursors were then selected for MS2/MS3 analysis. MS2 analysis consisted of quadrupole isolation (isolation window 0.7) of precursor ion followed by higher-energy collisional dissociation (HCD) in the ion trap (collision energy 36%, maximum injection time 120 ms). Following the acquisition of each MS2 spectrum, synchronous precursor selection enabled the selection of up to 10 MS2 fragment ions for MS3 analysis. MS3 precursors were fragmented by HCD and analyzed using the Orbitrap (collision energy 55%, maximum injection time 120 ms, resolution 30,000). For MS3 analysis, we used charge state dependent isolation windows. For charge state z = 2, the MS isolation window was set at 1.2; for z = 3 the MS isolation window was set at 0.7; for z = 4–6, the MS isolation window was set at 0.4.

MS data processing
Raw files were uploaded to the Integrated Proteomics Pipeline (IP2, version 6.7.1) available at http://ip2.scripps.edu/ip2/mainMenu.html and MS2 and MS3 files were extracted from the raw files using RAW Converter (version 1.1.0.22) available at http://fields.scripps.edu/rawconv/ and searched using the ProLuCID algorithm using a reverse concatenated, non-redundant variant of the Human UniProt database (release 2016–07). Cysteine residues were searched with a static modification for carboxyamidomethylation (+57.02146 Da). N-termini and lysine residues were also searched with a static modification corresponding to the TMT tag (+229.1629 Da for 10-plex and - +304.2071 Da for 16-plex). Peptides were required to be at least six amino acids long. ProLuCID data were filtered through DTASelect (version 2.0) to achieve a spectrum false-positive rate below 1%. We included a keratin filter. The MS3-based peptide quantification was performed with reporter ion mass tolerance set to 20 ppm with the Integrated Proteomics Pipeline (IP2).

Data analysis – Cysteine-directed ABPP
The census output files from Integrated Proteomics Pipeline 2 (IP2, v.6.7.1) were further processed to calculate cysteine engagement ratios (probe vs. DMSO) by dividing each TMT reporter ion intensity by the average intensity for the DMSO channels. Peptide-spectra matches were grouped based on protein ID and the cysteine residue number. Peptides with summed reporter ion intensities <10000, coefficient of variation for DMSO channels >0.5 were excluded from analysis. TMT ion intensities were median normalized per TMT channel. Two independent replicates of 10-plex experiments in 22Rv1 cells were analyzed together (total n = 2–4 per treatment condition). Data were averaged from all replicates.

Data analysis – Protein-directed ABPP
The census output files from IP2 were further processed to calculate enrichment engagement ratios (probe vs. probe) by dividing each TMT reporter ion intensity by the sum of intensity for all the channels. Each spectrum-peptide match was grouped based on protein ID, excluding peptides with summed reporter ion intensities <10,000, coefficient of variation of >0.5, <2 unique peptides per protein ID.

RNA-seq – Sample preparation
MCF7 cells (1 × 106 cells/treatment) were seeded in 2 mL media in a 6 well cm plate for 24 h. Media was then aspirated and replaced with 2 mL media containing the indicated compounds or 0.1% DMSO for 6 h. Following this incubation period, the cells were washed in cold DPBS, scraped, harvested and pelleted in 1.5 mL tubes (2000 g, 3 min, 4°C). Cell pellets were flash-frozen in liquid N2 and stored at −80°C until further analysis. Total RNA from thawed cells was isolated using RNeasy Plus Kit (QIAGEN) with QIAshredder columns for cell lysis (QIAGEN) according to the manufacturer’s protocol and stored at −80°C until further analysis. RNA concentration was measured by Nanodrop and 1–2 μg were used for sequencing.

RNA-seq – Library preparation with polyA selection and HiSeq sequencing
Library preparations and sequencing reactions were conducted at GENEWIZ, LLC. (South Plainfield, NJ, USA) as follows: Extracted RNA samples were quantified using Qubit 2.0 Fluorometer (Life Technologies) and RNA integrity was checked using Agilent TapeStation 4200 (Agilent Technologies). RNA sequencing libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB). Briefly, mRNAs were first enriched with Oligo(dT) beads. Enriched mRNAs were fragmented for 15 min at 94°C. First strand and second strand cDNAs were subsequently synthesized. cDNA fragments were end repaired and adenylated at 3′ ends, and universal adapters were ligated to cDNA fragments, followed by index addition and library enrichment by limited-cycle PCR. The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies) and quantified by using Qubit 2.0 Fluorometer (Invitrogen) as well as by quantitative PCR (KAPA Biosystems). The sequencing libraries were clustered on 2 lanes of a flowcell. After clustering, the flowcell was loaded on the Illumina HiSeq instrument (4000 or equivalent) according to manufacturer’s instructions. The samples were sequenced using a 2 × 150 bp Paired End (PE) configuration. Image analysis and base calling were conducted by the HiSeq Control Software (HCS). Raw sequence data (.bcl files) generated from Illumina HiSeq was converted into fastq files and de-multiplexed using Illumina’s bcl2fastq 2.17 software. One mismatch was allowed for index sequence identification.

RNA-seq – Data processing and quantification
Raw RNA-seq reads were processed using the nf-core/rnaseq pipeline (v3.13.2),54 which includes quality control with FastQC, adapter trimming, and alignment to the human reference genome (GRCh38) using STAR Salmon. Aligned reads were quantified at the gene level using featureCounts (v2.0.6) from the Subread package, with annotations derived from GENCODE release v29. Default parameters were used, and count matrices were generated for downstream differential expression analysis.

RNA-seq – Data analysis
Raw read counts were generated using FeatureCounts (v2.0.1) from aligned BAM files. Differential expression analysis was performed using the DESeq2 package (v1.40.1) in R (v4.3.1). Samples were initially collected in biological triplicate for each condition. However, quality control analysis revealed that two samples in different treatment groups behaved as outliers. These replicates were removed from the analysis to avoid skewing downstream results. To avoid unbalanced statistics, a principal component analysis based on variance-stabilizing transformation (VST) was used to remove one replicate in each group of triplicates that clustered separately from the other two. Final differential expression analysis was therefore performed using two biological replicates per condition. DESeq2’s standard pipeline was used, including size factor estimation, dispersion estimation, and negative binomial model fitting. Wald tests were used to determine statistical significance, and Benjamini-Hochberg correction was applied to control the false discovery rate (FDR). Genes with an adjusted p-value <0.01 were considered significantly differentially expressed.

Cell growth inhibition assays
Cells were seeded at 5000 cells per well (100 μL) in 96-well clear-bottom, white-wall plates. 100 μL of medium containing DMSO or compounds (2 × final concentrations) were added and cultured for 5 days (replacing media + compound every 48 h). On the day of reading, media was removed and replaced with 100 μL of fresh media before adding 100 μL CellTiterGlo reagent (Promega) for 30 min. Luminescence was then measured on a Clariostar plate reader (BMG Labtech). Relative cell growth was determined by normalizing the luminescence reading to the DMSO treated control.

Synthesis and characterization of compounds
Small molecules, including (R, R)-GL-373, its stereoisomers ((S, S)-GL-373, (R, S)-GL-373, (S, R)-GL-373), and alkyne-containing analogs ((R, R)-GL-586 and (S, S)-GL-586), were synthesized by adapting previously reported procedures.13 Detailed synthetic procedures and analytical data are provided in the STAR Methods (below) and Data S1.

General considerations
All NMR spectra were recorded at 298 K unless otherwise noted. 1H NMR spectra were recorded on Bruker Avance III 400, Avance III HD 400, Avance Neo 400 spectrometers (1H, 400 MHz). 13C NMR spectra were recorded on a ZKNJ QOne Quantum-I Plus 400 spectrometer (13C, 101 MHz). 19F NMR spectra were recorded on a Bruker AV Neo 399 MHz spectrometer (19F, 376 MHz). 1H NMR data are reported as follows: chemical shift (δ), multiplicity (s = singlet, d = doublet, t = triplet, m = multiplet; br = broad), coupling constants, and integration. Chemical shifts are reported in parts per million (ppm) using the appropriate solvent as reference.55 Analytical supercritical fluid chromatography (SFC) was performed on a Shimadzu LC system (flow rate: 3 mL/min, back pressure: 100 Bar, column temperature: 35°C) equipped with a polydiode array detector. Mass measurements for high-resolution mass spectrometry (HRMS) were performed on a Waters Xevo G2-XS TOF calibrated against sodium formate clusters and using a LeuEnk lockmass. Expected monoisotopic masses were calculated using MassLynx 4.1 and the m/z values for calibrant and lockmass were MassLynx-default values.

Synthesis of (-R, R)-GL-373

Lithium (R)-4-(tert-butoxycarbonyl)piperazine-2-carboxylate (S2)
To a solution of S1 (2.00 g, 8.19 mmol, 1.0 equiv) in MeOH (20 mL) were added LiOH·H2O (515 mg, 12.3 mmol, 1.5 equiv) and H2O (2 mL). The mixture was stirred at 25°C for 12 h. On completion, the reaction mixture was concentrated under reduced pressure to give S2 (1.95 g, quant.) as a yellow solid, which was used in the next step without further purification.

tert-butyl (R)-3-((4-methoxybenzyl)carbamoyl)piperazine-1-carboxylate (S3)
To a precooled (0°C) solution of S2 (300 mg, 1.27 mmol, 1.0 equiv) and 4-methoxybenzylamine (192 mg, 1.40 mmol, 1.1 equiv) in DMF (5 mL) were added PyBOP (991 mg, 1.91 mmol, 1.5 equiv) and triethylamine (386 mg, 3.81 mmol, 3.0 equiv). The mixture was stirred at 0°C for 2 h. On completion, the reaction mixture was concentrated under reduced pressure to give a residue, which was purified by reverse-phase-HPLC (A: H2O (10 mM NH4HCO3), B: acetonitrile; gradient: B%: 0%–100%, 20 min) and purified by prep-HPLC (column: Waters Xbridge Prep OBD C18 150*40 mm*10 um; mobile phase: [H2O (0.05% NH3·H2O)-acetonitrile]; gradient: 29%–59% B over 15.0 min) to give S3 (0.30 g, 68% yield) as a white solid.
1H NMR (400 MHz, CDCl3) δ 7.19 (d, J = 8.2 Hz, 2H), 7.11–6.94 (m, 1H), 6.86 (d, J = 8.8 Hz, 2H), 4.37 (d, J = 5.8 Hz, 2H), 4.14–4.06 (m, 1H), 3.84–3.73 (m, 1H), 3.80 (s, 3H), 3.35 (dd, J = 9.3, 3.6 Hz, 1H), 3.01 (t, J = 11.4 Hz, 1H), 2.91 (d, J = 12.3 Hz, 2H), 2.76 (t, J = 11.4 Hz, 1H), 1.45 (s, 9H), 1 exchangeable proton not observed.
LC-MS m/z calc. for C18H28N3O4 [M + H]+ 350.2 found 350.2.

tert-butyl (R)-3-((4-methoxybenzyl)carbamoyl)-4-((4-methoxyphenyl)sulfonyl)piperazine-1-carboxylate (S4)
To a precooled (0°C) solution of S3 (0.30 g, 859 μmol, 1.0 equiv) and triethylamine (261 mg, 2.58 mmol, 3.0 equiv) in dichloromethane (10 mL) was added (4-methoxyphenyl)sulfonyl chloride (266 mg, 1.29 mmol, 1.5 equiv). The mixture was stirred at 0°C for 2 h. On completion, the reaction mixture was concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (SiO2, petroleum ether/EtOAc = 5:1 to 2:1) to give S4 (0.35 g, 78% yield) as a white solid.
1H NMR (400 MHz, CDCl3) δ 7.75 (d, J = 9.0 Hz, 2H), 7.15 (d, J = 8.6 Hz, 2H), 6.97 (d, J = 9.0 Hz, 2H), 6.85 (d, J = 8.7 Hz, 2H), 6.82–6.76 (m, 1H), 4.63–4.51 (m, 1H), 4.48–4.25 (m, 3H), 3.87 (s, 3H), 3.80 (s, 3H), 3.80–3.57 (m, 2H), 3.32–3.21 (m, 1H), 2.91–2.58 (m, 2H), 1.41 (s, 9H).
LC-MS m/z calc. for C25H34N3O7S [M + H]+ 520.2 found 520.2.

(R)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl)piperazine-2-carboxamide (S5)
To a solution of S4 (1.00 g, 1.92 mmol) in dioxane (2 mL) was added HCl (2 M solution in dioxane, 5 mL, 5.2 equiv). The mixture was stirred at 20°C for 2 h. On completion, the reaction mixture was concentrated in vacuo to give S5·HCl (750 mg, 90% w/w [dioxane], 77% yield) as a white solid, which was used in the next step without further purification.
1H NMR (400 MHz, CD3OD) δ 8.45 (t, J = 4.4 Hz, 1H), 7.80 (d, J = 8.9 Hz, 2H), 7.19 (d, J = 8.7 Hz, 2H), 7.04 (d, J = 9.0 Hz, 2H), 6.88 (d, J = 8.7 Hz, 2H), 4.76 (d, J = 4.5 Hz, 1H), 4.33–4.15 (m, 2H), 4.00 (dd, J = 14.5, 3.8 Hz, 1H), 3.88 (s, 3H), 3.79 (s, 3H), 3.72–3.59 (m, 3H + dioxane), 3.34 (m, 1H), 3.07 (dd, J = 13.2, 4.6 Hz, 1H), 2.96 (td, J = 12.8, 4.1 Hz, 1H).
LC-MS m/z calc. for C20H26N3O5S [M + H]+ 420.2 found 420.2.

(R)-4-((R)-2-chloro-2-fluoroacetyl)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((R, R)-GL-373)
To a precooled (0°C) solution of S5·HCl (160 mg, 90% w/w [dioxane], 316 μmol, 1.0 equiv), DIPEA (181 mg, 1.40 mmol, 4.4 equiv) and (R)-chlorofluoroacetic acid (59.2 mg, 526 μmol, 1.7 equiv) in dichloromethane (2 mL) was added HATU (267 mg, 702 μmol, 2.2 equiv). The mixture was stirred at 0°C for 1 h. On completion, the reaction mixture was concentrated in vacuo. The residue was purified by prep-TLC (SiO2, petroleum ether/EtOAc = 2:1) and prep-HPLC (column: Waters xbridge 150*25 mm 10 μm; mobile phase: A: H2O (10 mM NH4HCO3), B: acetonitrile; gradient: 30%–60% B over 15.0 min) to give (R, R)-GL-373 (80.0 mg, 49% yield) as a white amorphous solid.
Note: NMR spectra are consistent with a 7:3 mixture of rotamers.
1H NMR (400 MHz, CDCl3): δ 7.73 (d, J = 9.0 Hz, 2H), 7.20–7.07 (m, 2H), 7.04–6.93 (m, 3H), 6.92–6.76 (m, 2.7H), 6.35 (d, 2JHF = 50.4 Hz, 0.3H), 4.84 (d, J = 13.7 Hz, 0.3H), 4.56–4.41 (m, 1.7H), 4.41–4.19 (m, 2H), 4.11 (d, J = 13.7 Hz, 0.7H), 3.99–3.65 (m, 7.3H), 3.55–3.38 (m, 0.3H), 3.31–3.07 (m, 1H), 2.99 (dd, J = 14.1, 4.2 Hz, 0.7H), 2.77 (dd, J = 14.0, 4.5 Hz, 0.3H), 2.65 (t, J = 12.3 Hz, 0.7H).
19F NMR (376 MHz, CDCl3): δ 142.93, 139.69.
13C NMR (101 MHz, CDCl3) δ 167.32, 167.18, 163.79, 163.59, 161.90, 161.68, 159.14, 130.11, 129.41, 129.30, 129.12, 128.93, 115.04, 114.75, 114.21, 114.08, 97.15, 95.48, 94.69, 92.91, 56.03, 55.77, 55.73, 55.30, 50.79, 43.59, 43.54, 43.44, 43.25, 42.50, 42.25, 41.95, 41.12.
HRMS m/z calc. for C22H26ClFN3O6S [M + H]+ 514.1215 found 514.1217.

Synthesis of stereoisomers of (R, R)-GL-373
(S)-4-((S)-2-chloro-2-fluoroacetyl)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((S, S)-GL-373). (S, S)-GL-373 was prepared from ent-S5⋅HCl and (S)-chlorofluoroacetic acid following a procedure analogous to that used for the synthesis of (R, R)-GL-373.
Note: NMR spectra are consistent with a 7:3 mixture of rotamers.
1H NMR (400 MHz, CDCl3) δ 7.74 (d, J = 8.9 Hz, 2H), 7.18–7.09 (m, 2H), 7.06–6.89 (m, 3.3H), 6.88–6.75 (m, 2.4H), 6.35 (d, 2JHF = 50.4 Hz, 0.3H), 4.85 (d, J = 13.7 Hz, 0.3H), 4.56–4.42 (m, 1.7H), 4.42–4.20 (m, 2H), 4.12 (d, J = 13.7 Hz, 0.7H), 4.00–3.67 (m, 7.3H), 3.45 (t, J = 12.3 Hz, 0.3H), 3.30–3.09 (m, 1H), 2.99 (dd, J = 14.0, 4.2 Hz, 0.7H), 2.85–2.73 (m, 0.3H), 2.65 (t, J = 12.3 Hz, 0.7H).
19F NMR (376 MHz, CDCl3): δ 142.84, 139.64.
13C NMR (101 MHz, CDCl3) δ 167.28, 167.09, 163.81, 161.89, 161.67, 159.16, 130.12, 129.87, 129.33, 129.16, 128.95, 115.06, 114.77, 114.22, 97.22, 94.82, 56.07, 55.82, 55.39, 55.27, 43.49, 42.51, 41.84, 41.10.
HRMS m/z calc. for C22H26ClFN3O6S [M + H]+ 514.1215 found 514.1219.
(R)-4-((S)-2-chloro-2-fluoroacetyl)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((S, R)-GL-373). (S, R)-GL-373 was prepared from S5·HCl and (S)-chlorofluoroacetic acid following a procedure analogous to that used for the synthesis of (R, R)-GL-373.
Note: NMR spectra are consistent with a 9:1 mixture of rotamers.
1H NMR (400 MHz, CDCl3) δ 7.75 (d, J = 9.0 Hz, 2H), 7.17–6.93 (m, 6H), 6.89–6.81 (m, 2H), 6.34 (d, 2JHF = 50.7 Hz, 0.1H), 4.82 (d, J = 13.7 Hz, 0.1H), 4.45 (d, J = 3.7 Hz, 1H), 4.41–4.20 (m, 4H), 3.95–3.83 (m, 4H), 3.79 (s, 3H), 3.11 (ddd, J = 15.1, 12.1, 3.4 Hz, 1H), 2.81 (dd, J = 14.0, 4.0 Hz, 1H), 2.45 (td, J = 13.1, 3.5 Hz, 1H).
19F NMR (376 MHz, CDCl3): δ 147.73, 141.33.
13C NMR (101 MHz, CDCl3) δ 167.23, 167.13, 163.83, 162.95, 162.70, 159.19, 159.08, 130.47, 129.93, 129.26, 129.21, 129.08, 128.90, 115.15, 114.83, 114.27, 91.11, 91.04, 88.64, 88.59, 56.06, 56.01, 55.89, 55.74, 55.40, 55.26, 43.56, 43.41, 42.86, 42.77, 40.42, 40.32.
HRMS m/z calc. for C22H26ClFN3O6S [M + H]+ 514.1215 found 514.1209.
(S)-4-((R)-2-chloro-2-fluoroacetyl)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((R, S)-GL-373). (R, S)-GL-373 was prepared from ent-S5·HCl and (R)-chlorofluoroacetic acid following a procedure analogous to that used for the synthesis of (R, R)-GL-373.
Note: NMR spectra are consistent with a 9:1 mixture of rotamers.
1H NMR (400 MHz, CDCl3) δ 7.75 (d, J = 8.9 Hz, 2H), 7.17–6.93 (m, 6H), 6.84 (d, J = 8.6 Hz, 2H), 6.35 (d, 2JHF = 50.6 Hz, 0.1H), 4.82 (d, J = 13.7 Hz, 0.1H), 4.53–4.43 (m, 1H), 4.41–4.18 (m, 4H), 3.94–3.83 (m, 4H), 3.79 (s, 3H), 3.11 (ddd, J = 15.0, 12.1, 3.4 Hz, 1H), 2.81 (dd, J = 14.0, 4.0 Hz, 1H), 2.45 (td, J = 12.8, 3.5 Hz, 1H).
19F NMR (376 MHz, CDCl3): δ 147.73, 141.34.
13C NMR (101 MHz, CDCl3) δ 167.23, 167.14, 163.82, 162.95, 162.70, 159.19, 130.47, 129.26, 129.22, 129.08, 128.90, 115.14, 114.84, 114.26, 91.11, 91.04, 88.63, 56.06, 56.01, 55.88, 55.74, 55.40, 55.27, 43.56, 43.41, 42.87, 42.78, 40.43.
HRMS m/z calc. for C22H26ClFN3O6S [M + H]+ 514.1215 found 514.1212.

Synthesis of alkyne-containing analogs of (R, R)-GL-373

tert-butyl (R)-3-((4-ethynylbenzyl)carbamoyl)piperazine-1-carboxylate (S6)
To a solution of S2 (300 mg, 1.27 mmol, 1 equiv) and 4-ethynylbenzylamine (234 mg, 1.40 mmol, 1.1 equiv) in DMF (5 mL) were added DIPEA (492 mg, 3.81 mmol, 3.0 equiv) and HATU (724 mg, 1.91 mmol, 1.5 equiv). The mixture was stirred at 0°C for 2 h. On completion, the reaction mixture was diluted with H2O (20 mL) and extracted with EtOAc (20 mL × 3). The combined organic layers were dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue and purified by reversed-phase HPLC (A: H2O (10 mM NH4HCO3), B: acetonitrile; gradient: B: 30–50%, 20 min) to give S6 (150 mg, 77% purity) as a yellow solid. Further purification by reversed-phase HPLC (A: H2O (10 mM formic acid), B: acetonitrile; gradient: B: 30–50%, 20 min) gave S6·HCO2H (100 mg, 20% yield) as a white solid.
1H NMR (400 MHz, CDCl3) δ 8.12 (s, 1H, formate), 7.45 (d, J = 8.0 Hz, 2H), 7.35–7.26 (m, 1H), 7.21 (d, J = 7.9 Hz, 2H), 4.43 (d, J = 5.9 Hz, 2H), 4.07 (dd, J = 13.5, 3.7 Hz, 1H), 3.95–3.68 (m, 1H), 3.68–3.43 (m, 4H), 3.31–2.88 (m, 3H), 2.81 (ddd, J = 12.8, 9.7, 3.4 Hz, 1H), 1.45 (s, 9H).
LC-MS m/z calc. for C15H18N3O3 [M-tBu+2H]+ 288.1 found 288.2.

tert-butyl (R)-3-((4-ethynylbenzyl)carbamoyl)-4-((4-methoxyphenyl)sulfonyl)piperazine-1-carboxylate (S7)
To a precooled (0°C) solution of S6·HCO2H (100 mg, 0.257 mmol) in dichloromethane (5 mL) were added triethylamine (84.9 mg, 0.839 mmol, 3.3 equiv) and 4-methoxysulfonyl chloride (116 mg, 0.559 mmol, 2.2 equiv). The mixture was stirred at 0°C for 1 h. On completion, the reaction mixture was concentrated under reduced pressure to give a residue, which was purified by flash silica gel chromatography (SiO2, hexanes/EtOAc = 7:3 to 1:1) to give S7 (40 mg, 26% yield) as a white solid.
1H NMR (400 MHz, CDCl3) δ 7.76 (d, J = 8.9 Hz, 2H), 7.45 (d, J = 8.2 Hz, 2H), 7.19 (d, J = 7.9 Hz, 2H), 6.98 (d, J = 8.9 Hz, 2H), 6.95–6.90 (m, 1H), 4.65–4.34 (m, 4H), 3.88 (s, 3H), 3.84–3.59 (m, 2H), 3.33–3.21 (m, 1H), 3.07 (s, 1H), 2.85–2.61 (m, 2H), 1.41 (s, 9H).
LC-MS m/z calc. for C27H32N3O6S [M + H]+ 514.2 found 514.1.

(R)-N-(4-ethynylbenzyl)-1-((4-methoxyphenyl)sulfonyl)piperazine-2-carboxamide (S8)
To a solution of S7 (200 mg, 389 μmol) in dioxane (1 mL) was added HCl/dioxane (4 M, 2 mL) and the resulting mixture was stirred at 25°C for 1 h. On completion, the reaction mixture was concentrated to give compound S8·HCl (160 mg, quant.) as a yellow solid, which was used in the next step without further purification.

(R)-4-((R)-2-chloro-2-fluoroacetyl)-N-(4-ethynylbenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((R, R)-GL-586)
To a precooled (0°C) solution of (R)-chlorofluoroacetic acid (26.1 mg, 232 μmol), HATU (147 mg, 387 μmol) and DIEA (75.0 mg, 580 μmol) in dichloromethane (10 mL) was added S8·HCl (80.0 mg, 193 μmol) and the mixture was stirred at 0°C for 2 h. On completion, the reaction mixture was partitioned between ethyl acetate (60 mL) and brine (40 mL). Then, the aqueous layer was extracted with ethyl acetate (40 mL × 3). The organic layers were combined, dried over sodium sulfate, filtered and concentrated under reduced pressure to give a residue, which was purified by prep-TLC (SiO2, petroleum ether/EtOAc = 2:1) and prep-HPLC (column: Waters Xbridge 150*25 mm* 5 um; mobile phase: A: H2O (10 mM NH4HCO3), B: acetonitrile; gradient: B: 40%–70% over 9 min) to give (R, R)-GL-586 (26.0 mg, 26% yield) as a white solid.
Note: NMR spectra are consistent with a 3:2 mixture of rotamers.
1H NMR (400 MHz, CD3OD) δ 7.82–7.69 (m, 2H), 7.42 (d, J = 8.2 Hz, 2H), 7.23 (d, J = 7.9 Hz, 2H), 7.01 (t, J = 9.6 Hz, 2H), 6.91 (d, 2JHF = 49.2 Hz, 0.6H), 6.84 (d, 2JHF = 49.1 Hz, 0.4H), 4.70 (d, J = 13.7 Hz, 0.6H), 4.61–4.48 (m, 1H), 4.40–4.16 (m, 2.4H), 4.08 (br d, J = 13.7 Hz, 0.4H), 3.94 (d, J = 13.8 Hz, 0.6H), 3.87 (s, 3H), 3.83–3.71 (m, 1.6H), 3.70–3.58 (m, 0.4H), 3.46 (s, 1H), 3.39 (dd, J = 14.1, 4.7 Hz, 0.4H), 3.24 (ddd, J = 14.6, 9.9, 5.6 Hz, 0.6H), 3.09 (dd, J = 13.7, 4.7 Hz, 0.6H), 3.00 (t, J = 13.0 Hz, 0.4H), 1 exchangeable proton not observed.
HRMS m/z calc. for C23H24ClFN3O5S [M + H]+ 508.1109 found 508.1108.

(S)-4-((S)-2-chloro-2-fluoroacetyl)-N-(4-ethynylbenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((S, S)-GL-586)
(S, S)-GL-586 was prepared from ent-S8·HCl and (S)-chlorofluoroacetic acid following a procedure analogous to that used for the synthesis of (R, R)-GL-586.
Note: NMR spectra are consistent with a 3:2 mixture of rotamers.
1H NMR (400 MHz, MeOD) δ 7.81–7.70 (m, 2H), 7.42 (d, J = 8.0 Hz, 2H), 7.23 (d, J = 7.9 Hz, 2H), 7.01 (t, J = 9.8 Hz, 2H), 6.91 (d, 2JHF = 49.2 Hz, 0.6H), 6.84 (d, 2JHF = 49.1 Hz, 0.4H), 4.70 (d, J = 13.7 Hz, 0.6H), 4.58–4.50 (m, 1H), 4.40–4.16 (m, 2.4H), 4.12–4.04 (m, 0.4H), 3.95 (br d, J = 13.8 Hz, 0.6H), 3.87 (s, 3H), 3.84–3.71 (m, 1.6H), 3.70–3.57 (m, 0.4H), 3.46 (s, 1H), 3.39 (dd, J = 14.0, 4.6 Hz, 0.4H), 3.24 (ddd, J = 14.7, 10.0, 5.6 Hz, 0.6H), 3.09 (dd, J = 13.7, 4.7 Hz, 0.6H), 3.05–2.91 (m, 0.4H), 1 exchangeable proton not observed.
HRMS m/z calc. for C23H24ClFN3O5S [M + H]+ 508.1109 found 508.1118.

QUANTIFICATION AND STATISTICAL ANALYSIS
Statistical analysis was performed using GraphPad Prism version 9 for Windows (GraphPad Software, La Jolla California USA, https://www.graphpad.com/). Statistical values including the n and statistical significance are reported in the Figure legends. All details are included in figure legends.

ADDITIONAL RESOURCES
No additional resources were used in this study.

Supplementary Material

Supplementary Material
4321Supplemental information can be found online at https://doi.org/10.1016/j.chembiol.2025.12.010.

출처: PubMed Central (JATS). 라이선스는 원 publisher 정책을 따릅니다 — 인용 시 원문을 표기해 주세요.

🏷️ 같은 키워드 · 무료전문 — 이 논문 MeSH/keyword 기반

🟢 PMC 전문 열기