Association of lncRNA AGAP11 with prognosis and malignant progression in triple-negative breast cancer.

Introduction
Triple-negative breast cancer (TNBC) is one of the most aggressive subtypes of breast cancer (BC). Patients face a high risk of recurrence and metastasis, and its prognosis is poorer than that of other subtypes [1]. Currently, it is difficult to accurately identify high-risk TNBC patients with a poor prognosis using a prognostic evaluation system based on clinicopathological features [2]. Furthermore, abnormal cell behavior and the unique status of the tumor microenvironment have been confirmed as key factors in the malignant progression of TNBC, but the regulatory pathways associated with these processes are not fully elucidated [3]. Therefore, developing TNBC-specific prognostic markers and analyzing their potential regulatory mechanisms is crucial for the clinical management of TNBC.
Long non-coding RNAs (lncRNAs) have been proven to be ideal prognostic markers and therapeutic targets for tumors, and their regulatory networks are specific to tumor subtypes [4]. This offers a research direction for the highly heterogeneous TNBC subtype. One such lncRNA, AGAP11, has been found to be abnormally expressed in multiple cancer types and to inhibit cancer cell growth. In lung adenocarcinoma and squamous cell carcinoma, AGAP11 expression is closely associated with pathological parameters and inhibits tumor proliferation and metastasis [5, 6]. In hepatocellular carcinoma (HCC) and bladder cancer, AGAP11 has been confirmed as one of the core genes in the prognostic evaluation model [7, 8]. In ovarian cancer, the AGAP11 polymorphism site rs4934282 is significantly associated with patient survival [9]. Bioinformatics analysis shows that high AGAP11 expression in BC tissue is associated with longer patient survival, suggesting a potential role as a key member of the competing endogenous RNA (ceRNA) regulatory network [10]. ceRNA functions by competing with other RNA transcripts (e.g., mRNAs, lncRNAs) for shared microRNA response elements (MREs), thereby regulating target gene expression and contributing to processes like tumorigenesis. We hypothesize that AGAP11 influences breast cancer cell behavior by sequestering specific microRNAs. However, the role of AGAP11 in clinical TNBC samples remains unclear, and further investigations in this field could provide new insights for TNBC clinical assessment.
MicroRNAs (miRNAs) have high regulatory efficiency and often act as downstream effector molecules of lncRNAs to participate in regulatory networks. They are also important entry points for understanding tumor molecular mechanisms [11]. Among numerous miRNAs, miR-1269a is a key member of the miR-1269 family and has been identified as an oncogenic miRNA in various cancers, including HCC and non-small cell lung cancer [12]. It can promote tumor cell cycle progression and inhibit apoptosis by activating key signaling pathways (e.g., PI3K/AKT and TGF-β) [13, 14], and is positively correlated with tumor malignancy. It is an independent prognostic factor for reduced overall and disease-free survival [15, 16]. Bioinformatics analysis indicates that miR-1269a is up-regulated in BC tissues and exhibits targeted binding to AGAP11. However, the regulatory relationship between the two in TNBC remains unclear. Exploring their interaction could provide a new molecular perspective for TNBC research.
Based on the aforementioned research background and key scientific questions, this study aims to systematically analyze the expression characteristics of AGAP11 in TNBC tissues and to evaluate its association with clinicopathological parameters and clinical prognosis of patients. Using functional cellular assays, we seek to validate the targeted regulatory relationship between AGAP11 and miR-1269a, and further elucidate the role of the AGAP11/miR-1269a axis in modulating the malignant behavior of TNBC cells and maintaining tumor microenvironment homeostasis. The overarching objective is to provide novel experimental evidence and theoretical insights to support accurate prognostic assessment and the development of targeted therapeutic strategies for TNBC.

Patients and methods

Research subject inclusion and tissue sample collection
This study is a retrospective cohort study. The primary endpoints are: (1) to characterize AGAP11 expression in early-stage TNBC tissues and cells, analyze its association with tumor diameter, TNM stage, and lymph node metastasis, and evaluate its prognostic value for 5-year survival; and (2) to validate the direct interaction between AGAP11 and miR-1269a, examine how AGAP11 overexpression alone or with miR-1269a affects TNBC cell proliferation, migration, and invasion, and assess its impact on angiogenesis, inflammation, and stromal remodeling in the tumor microenvironment to elucidate AGAP11’s role in TNBC progression.
A cohort of 126 individuals diagnosed with early-stage TNBC who underwent surgical treatment at The People′s Hospital of Shuangqiao Economic-Technological Development Zone from January 2017 to November 2018 was enrolled in this study. The diagnosis of early-stage TNBC strictly follows the Chinese Guidelines for the Diagnosis and Treatment of Breast Cancer (2017 Edition): immunohistochemical assessment defines estrogen receptor (ER) and progesterone receptor (PR) status as negative when positive cells account for less than 1%; human epidermal growth factor receptor 2 (HER2) is considered negative with immunohistochemical scores of 0 or 1+, while a score of 2+ requires confirmation via fluorescence in situ hybridization (FISH) to rule out gene amplification prior to final classification, with only FISH-negative cases ultimately classified as HER2-negative. None of the participants had received preoperative interventions such as chemotherapy, radiotherapy, targeted therapy, or immunotherapy. Individuals with concurrent malignancies in other organ systems, significant organ dysfunction, active infections, as well as those who are pregnant or lactating, and patients with severe chronic comorbidities (including New York Heart Association functional class III–IV heart failure or active diabetic ketoacidosis) were excluded from the analysis.
During surgery, both tumor tissues and adjacent normal tissues were collected—adjacent normal tissues were sampled at a minimum distance of 5 cm from the tumor margin, histopathologically confirmed to be free of tumor cell infiltration, and used as controls to evaluate the differential expression of AGAP11 and miR-1269a between tumor and non-tumor tissues. Immediately after excision, tissue specimens were snap-frozen in liquid nitrogen.
Additionally, comprehensive clinical and histopathological data were collected, encompassing age, BMI, family history of BC, menopausal status, tumor location, tumor diameter, TNM staging, presence of lymph node metastasis (LNM), histological grade, Ki-67 proliferation index, and expression status of CK5/6 protein. To ensure uniformity in treatment protocols, only patients undergoing modified radical mastectomy were included in the study.
The study was reviewed and approved by the Medical Ethics Committee of The People’s Hospital of Shuangqiao Economic-Technological Development Zone, (Ethics Approval Number: 20161206) and all participants provided written informed consent.

Follow-up
Five-year follow-up evaluations commenced 3 months after hospital discharge and were conducted at 3-month intervals. The primary follow-up indicators included overall survival status, local tumor recurrence, and distant metastasis, which were confirmed through outpatient clinical assessments (including imaging examinations and laboratory tests) and electronic communication (telephone or online messaging) for participants unable to attend in-person visits. The follow-up period concluded upon the occurrence of death or the completion of the follow-up process. All 126 participants completed the follow-up without loss to follow-up, ensuring the completeness and reliability of survival data.

Cell culture and transfection
The normal breast epithelial cell MCF-10 A (used as a cellular control to assess molecular expression profiles in TNBC cell lines) and the TNBC cell lines MDA-MB-231 and BT-549 were obtained from ATCELLBIO (China). Cells were maintained in complete medium and incubated at 37 °C in a humidified atmosphere containing 5% CO₂ using a Binder (Germany) incubator.
For transfection experiments, MDA-MB-231 and BT-549 cells were seeded into 6-well plates. The experimental setup included the following groups: an untransfected control group (Control); a negative control group transfected with the empty pcDNA3.1 vector (oe-NC); an AGAP11 overexpression group transfected with the pcDNA3.1-AGAP11 plasmid (oe- AGAP11); a combined AGAP11 overexpression and miRNA negative control group (oe-AGAP11 + mimic-NC); and a co-overexpression group in which both AGAP11 and miR-1269a were up-regulated via co-transfection with pcDNA3.1-AGAP11 and a miR-1269a mimic (oe-AGAP11 + mimic-miR-1269a). These three parallel control groups (Control, oe-NC, mimic-NC) were designed to precisely delineate the specific effects of AGAP11 overexpression and co-overexpression of AGAP11 and miR-1269a on molecular expression patterns. All genetic constructs were custom-designed and synthesized by Packgene Corporation (China). Transfections were carried out using Hieff Trans® Liposomal 2000 Transfection Reagent according to the manufacturer’s protocol. After 48 h of post-transfection culture, cells were collected for subsequent analyses.

Fluorescence quantitative PCR (qPCR)
The qPCR was utilized to measure the expression levels of AGAP11 and miR-1269a in both tissue and cellular samples, and to determine mRNA expression changes in angiogenesis-related genes (VEGF, bFGF) following AGAP11 modulation.
Total RNA was isolated from specimens using TRIzol reagent (Invitrogen, USA), following the manufacturer’s protocol. To eliminate genomic DNA contamination, total RNA was treated with DNase I (Thermo Fisher, USA) at 37 °C for 30 min, followed by heat inactivation at 75 °C for 15 min. RNA purity was verified using a Nanodrop 2000 (Thermo Fisher, USA) with an A260/A280 ratio of 1.8–2.0, and RNA integrity was confirmed by agarose gel electrophoresis.
For cDNA synthesis, total RNA (1 µg) was reverse transcribed with the LunaScript® RT SuperMix Kit (NEB, USA). Oligo(dT) primers were used for the reverse transcription of AGAP11, VEGF, bFGF, and GAPDH, while stem-loop primers specific to miR-1269a and U6 were employed for their respective cDNA synthesis. The reaction conditions were 25 °C for 10 min, 55 °C for 30 min, and 85 °C for 5 min.
Quantitative PCR was performed using the Luna Universal qPCR Master Mix (NEB, USA) on an ABI 7500 Real-Time PCR System (Thermo Fisher, USA), with cDNA serving as the template. The amplification procedure followed the kit’s recommended cycling conditions. A 20 µL reaction system containing 10 µL Luna Universal qPCR Master Mix, 0.4 µL each of forward and reverse primers (10 µM), 2 µL cDNA template, and 7.6 µL RNase-free water. The amplification protocol was 95 °C for 60 s, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Each sample included 5 biological replicates and 3 technical replicates, with a no-template control (NTC) set to exclude contamination. GAPDH (forward: 5′-ACAACTTTGGTATCGTGGAAG-3′, reverse: 5′-GCCATCACGCCACAGTTT-3′) served as the endogenous control for AGAP11 (forward: 5′-TGCAGAGACCTGGAAGTTGT-3′, reverse: 5′-TTCCAGAGTGGAAGGACAAG-3′), VEGF (forward: 5′-AGCTACTGCCATCCAATCGC-3′, reverse: 5′-GGGCGAATCCAATTCCAAGAG -3′), and bFGF (forward: 5′-CTGGCTATGAAGGAAGATGGA-3′, reverse: 5′- TGCCCAGTTCGTTTCAGTG-3′) expression, whereas U6 (forward: 5′‑GCTTCGGCAGCACATATACTAAAAT‑3′, reverse: 5′‑CGCTTCACGAATTTGCGTGTCAT‑3′) snRNA was used as the reference gene for miR-1269a (forward: 5′‑CUGGACUGAGCCGUGCUACUGG‑3′, reverse: 5′‑CTCAACTGGTGTCGTGGA‑3′). All primers were designed and synthesized by Tsingke Corporation (China). Primer amplification efficiencies conformed to the MIQE guidelines. Melting curve analysis revealed a single peak for each primer pair, indicating specific amplification without detectable nonspecific products. Gradient dilution assays demonstrated amplification efficiencies ranging from 90 to 110%, with correlation coefficients (R²) ≥ 0.99, fulfilling the quality control standards for qPCR primers. Relative expression levels were calculated using the 2−ΔΔCt method.

CCK-8 assay
The CCK-8 assay was employed to assess the impact of AGAP11 overexpression and its co-overexpression with miR-1269a on the proliferative capacity of TNBC cells. MDA-MB-231 and BT-549 cells were harvested 48 h post-transfection and adjusted to a concentration of 5 × 10³ cells/mL. Each well of a 96-well plate was seeded with 100 µL of cell suspension (approximately 500 cells/well) to ensure uniform cell distribution. The plate was incubated at 37 °C with 5% CO₂ for 24 h to allow cell adhesion before initiating the proliferation assay. At time points (0, 24, 48, 72, and 96 h) post-seeding, 10 µL of CCK-8 reagent (Fine Test, China) was added to each well, and the plate was gently shaken for 1 min to mix thoroughly. After gentle shaking, the plates were incubated at 37 °C for 2 h. The optical density (OD) values were then measured using a SuPerMax 3100 multimode microplate reader (China). Each experimental group included 5 technical replicates, and the assay was independently repeated 3 times. The resulting OD readings were used to generate cell proliferation curves for each group.

Transwell assay
The Transwell migration and invasion assays were conducted to evaluate the effects of AGAP11 overexpression and its co-overexpression with miR-1269a on the migratory and invasive capabilities of TNBC cells. Following transfection, cells were adjusted to a concentration of 5 × 10⁴ cells/mL. The suspension (200 µL) was seeded into the upper compartment of a Transwell insert (8 μm pore size, Beyotime, China), while 600 µL of complete medium containing 10% FBS was added to the lower chamber. The plates were incubated at 37 °C for 24 h. Cells on the upper surface of the membrane were gently wiped off with a cotton swab, and cells that had migrated to the lower side of the membrane were fixed with 4% paraformaldehyde (Solarbio, China) for 30 min, stained with 0.1% crystal violet (Solarbio, China) for 20 min, rinsed gently to remove excess dye, and allowed to air dry.
For the invasion assay, the Transwell membranes were first coated with 50 µL of Matrigel matrix gel (1:8 dilution with serum-free medium, Beyotime, China) and incubated at 37 °C for 30 min to allow gel polymerization, after which the procedure proceeded identically to the migration assay. Migrated and invaded cells were visualized under an MX-E1 inverted microscope (Isite, China) at ×200 magnification, with 5 random fields counted per insert. The average number of cells was used for statistical analysis.

Enzyme-linked immunosorbent assay (ELISA)
ELISA was performed to quantify the secretion of inflammatory cytokines in cell culture supernatants, thereby reflecting alterations in the inflammatory status of the tumor microenvironment. The supernatant was collected from transfected cells cultured for 48 h and centrifuged at 12,000 rpm for 10 min at 4 °C to remove cell debris. The levels of secreted inflammatory cytokines, including IL-6, IL-8, and TGF-β1, were quantified using ELISA kits (R&D Systems, USA) according to the manufacturer’s protocol. A standard curve was constructed with 5 serial dilutions of standard substances (each concentration in triplicate), and the absorbance at 450 nm was measured using ELISA microplate reader. Sample concentrations were calculated based on the standard curve, and each sample was assayed in 5 biological replicates.

Western blot (WB)
WB was used to detect protein expression levels of stromal remodeling markers, elucidating the regulatory role of AGAP11 in extracellular matrix remodeling. The transfected cells were harvested and lysed in RIPA buffer (Thermo Fisher, USA) supplemented with 1% protease inhibitor (Solarbio, China) on ice for 30 min. Following lysis, the samples were centrifuged at 12,000 rpm for 15 min at 4 °C, and the supernatant containing total protein was carefully collected. Protein concentration was determined using the Omni Easy™ Ready-to-Use BCA Protein Assay Kit (Epizyme, China).
Equal amounts of protein (30 µg per sample) were separated by 10% SDS-PAGE using the Mini PROTEAN Tetra electrophoresis system (Bio-Rad, USA) at 80 V for 30 min and 120 V for 90 min. Proteins were then transferred onto PVDF membranes via wet blotting under constant current of 200 mA for 120 min.
Membranes were blocked with 5% non-fat milk in TBST for 1 h at room temperature, then incubated overnight at 4 °C with primary antibodies against MMP2 (1:1000, GTS, USA), MMP9 (1:1000, GTS, USA), and GAPDH (1:5000, Proteintech, USA). After washing with TBST (3 times, 10 min each), membranes were incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:5000, Epizyme, China) for 1 h at room temperature. Protein signals were visualized using the Super ECL Detection Reagent (Yeasen, China) on the Amersham ImageQuant™ 800 Western Blot Imaging System (Cytiva, China) with exposure times adjusted between 5 and 10 min based on signal intensity. Band intensities were quantified using ImageJ software, with GAPDH as the internal reference for normalization. Each experiment was repeated 5 times independently.

Dual-luciferase reporter gene assay
A dual-luciferase reporter assay was implemented to validate the direct targeting and binding interaction between AGAP11 and miR-1269a. The binding sites between AGAP11 and miR-1269a were identified using the TargetScan bioinformatics platform. To validate these interactions, wild-type AGAP11 (AGAP11-WT), containing the predicted binding sequences, and a mutated version (AGAP11-MUT), generated through site-directed mutagenesis, were respectively cloned into the psiCHECK™-2 dual-luciferase reporter vector. The correctness of the constructs was verified by Sanger sequencing (Tsingke, China).
MDA-MB-231 and BT-549 cells were seeded into 24-well plates at a density of 2 × 10⁴ cells/well and cultured for 24 h until reaching 70–80% confluence. Transfections were performed using Hieff Trans® Liposomal 2000 Transfection Reagent (Yeasen, China) following the manufacturer’s protocol. The AGAP11-WT/AGAP11-MUT construct (0.8 µg) was co-transfected with either the miR-1269a mimic, inhibitor, or corresponding NC (20 nM) into MDA-MB-231 and BT-549 cells. After 48 h of transfection, cells were washed twice with pre-cooled PBS and lysed with 100 µL of Passive Lysis Buffer (Yeasen, China) for 15 min at room temperature with gentle shaking.
Luciferase activities were measured using a dual-luciferase assay kit (Yeasen, China) on a Tristar LB 941 multimode microplate reader (Berthold, Germany). Briefly, 20 µL of cell lysate was mixed with 100 µL of Luciferase Assay Reagent II to detect firefly luciferase activity (FLuc), followed by adding 100 µL of Stop & Glo® Reagent to measure Renilla luciferase activity (RLuc). The relative luciferase activity was calculated as the ratio of FLuc to RLuc. Each experimental group included 5 biological replicates and 3 technical replicates, and the assay was independently repeated 3 times to ensure reproducibility.

Statistical analysis
To assess differences in continuous variables, a t-test was applied for comparisons between two groups, while analysis of variance was employed for comparisons across multiple groups. Categorical variables were analyzed using the chi-square test. In this study, the chi-square test was used to assess the association between AGAP11 expression and key clinicopathological features in TNBC patients one by one, to control for the influence of each confounding factor. The relationship between AGAP11 and miR-1269a expression levels was evaluated through Pearson analysis. Survival curves were generated using the Kaplan-Meier method. Additionally, a multivariate Cox proportional hazards regression models were utilized to identify prognostic risk factors in patients with TNBC, with adjustment for baseline demographic variables and tumor-related confounding factors to attenuate the influence of potential biases and confounding factors on the study outcomes. Cell-based experiments were performed with 5 biological replicates and 3 technical replicates, and quantitative data in the bar graphs are expressed as mean ± standard deviation (SD).

Results

The expression of AGAP11 in TNBC tissues and cell lines
To investigate AGAP11 expression patterns, we compared its levels between TNBC tissues and adjacent normal tissues, as well as between TNBC cell lines and normal breast epithelial cells MCF-10 A. AGAP11 was markedly reduced in TNBC tissues compared to normal tissues (P < 0.001; Fig. 1A). Similarly, at the cellular level, AGAP11 levels were significantly lower in TNBC cell lines (MDA-MB-231 and BT-549) than in MCF-10 A (P < 0.001; Fig. 1B).

The relationship between AGAP11 expression and the clinical parameters of TNBC patients
The median AGAP11 expression level in TNBC tissues was used as the cutoff value to classify 126 patients into two groups: low AGAP11 expression (n = 63) and high AGAP11 expression (n = 63).
No significant associations were observed between AGAP11 expression levels and age, BMI, family history of BC, menopausal status, or tumor location (P > 0.05). Notably, low AGAP11 expression was significantly correlated with larger tumor diameter (≥ 2 cm; P = 0.031), advanced TNM stage (stage III; P = 0.007), presence of LNM (P = 0.004), higher histological grade (grade 3; P = 0.011), increased Ki-67 proliferation index (≥ 14%; P = 0.001), and positive CK5/6 immunoreactivity (P = 0.002; Table 1).

The influence of AGAP11 expression on the prognosis of TNBC patients
The median follow-up duration for the 126 patients with early-stage TNBC was 52 months. This period encompasses the high-risk window for major prognostic events in TNBC, and all patients completed the full follow-up with no loss to follow-up, ensuring the completeness and reliability of the longitudinal data and providing a robust representation of long-term survival outcomes.
Cox regression model analysis was performed to evaluate the impact of clinical information, pathological features, and AGAP11 expression on patient outcomes. Several significant negative prognostic factors for TNBC were identified: advanced TNM stage [hazard ratio (HR) = 2.469; P = 0.022], presence of LNM (HR = 3.151; P = 0.007), high Ki-67 proliferation index (HR = 2.734; P = 0.031), positive CK5/6 expression (HR = 2.850; P = 0.009), and low AGAP11 expression (HR = 0.254; P = 0.006). Among these, LNM, CK5/6 positivity, and reduced AGAP11 levels showed a particularly strong association with poorer prognosis (P < 0.01). Additionally, although not statistically significant, tumor diameter (P = 0.085) and histological grade (P = 0.055) exhibited potential effects on survival outcomes (Fig. 2A).

Kaplan-Meier survival analysis indicated that the 5-year survival rate of the entire cohort was 70.6%. Patients with high AGAP11 expression had a significantly higher 5-year survival rate (P = 0.003), indicating that elevated AGAP11 levels are associated with improved prognosis (Fig. 2B).

The effect of AGAP11 overexpression on the biological behavior of TNBC cells
After AGAP11 overexpression in MDA-MB-231 and BT-549 cells, qPCR results confirmed a marked upregulation of AGAP11 expression in both cell lines (P < 0.001), verifying efficient transfection (Fig. 3A).

The OD values of cells in the AGAP11-overexpressing group were significantly reduced at 48, 72, and 96 h post-culture (P < 0.05), suggesting that AGAP11 overexpression significantly suppressed the proliferative capacity of TNBC cells (Fig. 3B and C).
Compared with the control groups, overexpression of AGAP11 led to a significant decrease in the number of migratory (P < 0.001) and invasive (P < 0.01) cells in both MDA-MB-231 and BT-549 cells (Fig. 3D and E).

The effect of AGAP11 overexpression on tumor microenvironment-related factors in TNBC cells
At the mRNA level, the expression of key angiogenic factors VEGF and bFGF was significantly decreased in MDA-MB-231 and BT-549 cells following AGAP11 overexpression (P < 0.05; Fig. 4A and B).

Regarding pro-inflammatory cytokine secretion, the levels of IL-6, IL-8, and TGF-β1 in the cell culture supernatants were significantly lower in the AGAP11-overexpressing group (P < 0.01; Fig. 4C and D).
In addition, AGAP11 overexpression resulted in a substantial reduction in the protein expression of matrix remodeling enzymes MMP2 and MMP9 in both TNBC cell lines (P < 0.001; Fig. 4E and F, Supply 1).

The expression of miR-1269a in TNBC tissues and cells and its targeting relationship with AGAP1
Similarly, miR-1269a expression was analyzed by comparing TNBC tissues with adjacent normal tissues and TNBC cell lines with MCF-10 A cells. miR-1269a expression was significantly up-regulated in TNBC tissues (P < 0.001; Fig. 5A) and TNBC cell lines (MDA-MB-231 and BT-549; P < 0.001; Fig. 5B). A strong inverse correlation was observed between AGAP11 and miR-1269a expression levels in TNBC tissue samples (r = -0.696; P < 0.001; Fig. 5C).

Bioinformatics analysis predicted a potential binding site between miR-1269a and the 3’UTR of AGAP11 (Fig. 5D). In both MDA-MB-231 and BT-549 cells, transfection with the miR-1269a mimic significantly reduced luciferase activity in the AGAP11-WT vector group (P < 0.05), while the miR-1269a inhibitor markedly increased it (P < 0.001). In contrast, no significant changes in luciferase activity were detected in the AGAP11-MUT vector group upon transfection with the miR-1269a mimic or inhibitor (P > 0.05; Fig. 5E and F), confirming the specific binding interaction between AGAP11 and miR-1269a.

The effect of co-overexpression of AGAP11 and miR-1269a on the biological behavior of TNBC cells
Overexpression of AGAP11 alone in MDA-MB-231 and BT-549 cells significantly decreased miR-1269a expression levels (P < 0.01). However, when AGAP11 and miR-1269a were co-overexpressed, miR-1269a levels were markedly restored (P < 0.01; Fig. 6A).

Co-transfection with miR-1269a mimic counteracted the suppressive effect of AGAP11 overexpression on cell proliferation. Specifically, the proliferative capacity of MDA-MB-231 cells was significantly enhanced at 48 h (P < 0.05; Fig. 6B), and that of BT-549 cells was notably increased at 72 h (P < 0.001; Fig. 6C) compared to the AGAP11-only overexpression group.
Relative to AGAP11 overexpression alone, simultaneous overexpression of AGAP11 and miR-1269a resulted in a significant recovery of migratory and invasive capabilities in both cell lines, as reflected by a substantial increase in the number of migrated and invaded cells (P < 0.05; Fig. 6D and E).

The effect of co-overexpression of AGAP11 and miR-1269a on tumor microenvironment-related factors
Compared with AGAP11 overexpression alone, co-overexpression of AGAP11 and miR-1269a significantly enhanced the mRNA expression levels of the angiogenic factors VEGF and bFGF in MDA-MB-231 and BT-549 cells (P < 0.05; Fig. 7A and B).

Co-overexpression of AGAP11 and miR-1269a effectively counteracted the suppressive effect of AGAP11 on the pro-inflammatory cytokines secretion, leading to a significant increase in IL-6, IL-8, and TGF-β1 levels (P < 0.05; Fig. 7C and D), thereby intensifying the inflammatory microenvironment.
Relative to the AGAP11 overexpression group, combined overexpression of AGAP11 and miR-1269a significantly reversed the protein expression of matrix remodeling enzymes MMP2 and MMP9 in both TNBC cell lines (P < 0.05; Fig. 7E and F, Supply 1).

Discussion
TNBC patients tend to develop the disease at a younger age, with faster distant metastasis and poorer prognosis compared to other BC subtypes [17]. Clinically, TNBC prognosis is assessed using pathological parameters such as TNM staging and traditional tumor markers. However, TNM staging fails to accurately identify high-risk patients with occult disease, and tumor markers have limited predictive value [18]; neither meets the needs of individualized clinical management. Mechanistically, the malignant progression of TNBC involves multi-pathway dysregulation, but the key molecular networks remain unclear, hindering the development of targeted therapeutic strategies [19]. Therefore, identifying novel biomarkers with prognostic and interventional value is crucial for the clinical management of TNBC.
LncRNAs, characterized by strong tissue specificity and close associations with tumor phenotypes and prognosis, are key targets in tumor molecular biomarker research [20]. In TNBC, multiple studies have confirmed the clinical utility of specific lncRNAs. For example, HCG11 overexpression correlates with LNM and poor survival [21]. SNHG15 can serve as a predictor of therapeutic responses [22]. LINC01315 is significantly up-regulated in TNBC and correlates with disease progression and poor prognosis [23]. AGAP11 is down-regulated in malignant tumors, such as lung cancer and HCC, and this down-regulation correlates with prognosis and high-risk clinical features [5–8]. Consistent with existing bioinformatics analyses [10], this study revealed low AGAP11 expression in both TNBC tissues and cells. In TNBC, a tumor diameter of ≥ 2 cm, TNM stage III, and positive LNM indicate that the tumor has acquired the ability to invade locally or disseminate via the lymphatic system [24]. Histological grade 3 and a Ki-67 proliferation index of ≥ 14% reflect poorly differentiated and highly proliferative tumor cells, which are important indicators of rapid TNBC progression [25]. CK5/6 positivity is associated with high tumor invasiveness and increased risk of drug resistance [26]. In this study, low AGAP11 expression was significantly associated with these high-risk parameters, suggesting its potential as an additional indicator for clinical risk stratification in TNBC. Further analysis confirmed that AGAP11 was an independent risk factor for poor prognosis in TNBC patients, with higher expression correlating with better outcomes. These findings support AGAP11 as a novel molecular biomarker for assessing clinical prognosis in TNBC, providing critical molecular evidence for identifying high-risk patients. However, this study could not perform stratified analyses for postoperative treatments like chemotherapy or radiotherapy due to the retrospective design and incomplete records on regimens, dosages, and treatment durations. We acknowledge this may confound survival interpretation. In a future multicenter prospective study, we will collect full pre- and post-treatment data to validate AGAP11’s prognostic role across different treatment settings. Furthermore, patients receiving neoadjuvant chemo-immunotherapy—the current standard of care for early-stage TNBC—was not included in this study, as the enrollment period (2017–2018) predates the adoption of this regimen as a standard treatment at our institution. During this period, clinical application of chemo-immunotherapy was limited, making recruitment of sufficient cases unfeasible. We acknowledge that this limitation may affect the generalizability of our findings. Future studies will prioritize this patient population to evaluate the clinical relevance of AGAP11 within contemporary treatment frameworks.
The malignant progression of TNBC is closely associated with abnormal cellular behavior and disruption of tumor microenvironment homeostasis. Uncontrolled cell proliferation drives tumor expansion, while enhanced migration and invasion capabilities promote distant metastasis [27]. Within the tumor microenvironment, angiogenesis supplies nutrients and oxygen to the tumor, inflammatory responses induce immune suppression and inhibit anti-tumor immunity, and matrix remodeling provides physical pathways for tumor cell invasion. These three processes synergistically accelerate TNBC malignant progression [28, 29]. MDA-MB-231 and BT-549 are commonly used functional TNBC cell lines: the former exhibits strong proliferation and invasion capabilities and secretes pro-angiogenic factors, mimicking the malignant phenotype of advanced TNBC; the latter demonstrates excellent matrix invasion capacity, consistent with the behavior of TNBC lesions characterized by matrix infiltration [30]. This study found that up-regulating AGAP11 expression significantly inhibited the malignant behavior of both cell lines, while simultaneously down-regulating key molecules associated with angiogenesis, inflammatory responses, and matrix remodeling in the tumor microenvironment. This suggests that AGAP11 not only regulates the malignant phenotype of TNBC cells but also suppresses disease progression by intervening in tumor microenvironment homeostasis, further confirming its crucial role as a tumor-suppressive lncRNA in TNBC.
MiRNA serves as the core downstream molecule through which lncRNAs exert their regulatory effects, often forming ceRNA networks to regulate disease progression [31]. To elucidate the molecular mechanism by which AGAP11 regulates TNBC, this study selected miR-1269a as a potential downstream target based on bioinformatics predictions and literature reports. As previously described, miR-1269a is positively correlated with tumor malignancy in multiple cancers, promoting tumor proliferation and metastasis by targeting tumor suppressor genes or activating cancer pathways [12–14, 32]. Furthermore, bioinformatics database predictions identified a complementary binding site for miR-1269a within the AGAP11 sequence. In TNBC tissues, miR-1269a level showed a significant negative correlation with AGAP11. Functional experiments confirmed that AGAP11 directly binds to the seed region of miR-1269a, thereby inhibiting its activity. Rescue experiments demonstrated that co-upregulation of AGAP11 and miR-1269 significantly reversed the suppressive effects of AGAP11 on TNBC cell malignant behavior and the tumor microenvironment, confirming that AGAP11 exerts its regulatory role via the AGAP11/miR-1269a axis. Low AGAP11 expression in TNBC weakens its binding to miR-1269a, releasing the oncogenic effects of miR-1269a on downstream target genes. This enhances the malignant behavior of TNBC cells and disrupts tumor microenvironment homeostasis, ultimately driving TNBC malignant progression. AGAP11 is low in lung cancer and hepatocellular carcinoma, where it inhibits tumor cell proliferation and metastasis and correlates with poor prognosis, serving mainly as a core or independent prognostic marker. In TNBC, AGAP11 retains this “low expression–poor outcome” pattern and additionally shows a unique mechanism: via the AGAP11/miR-1269a axis, it regulates TNBC cell malignancy (proliferation, migration, invasion) and key tumor microenvironment features (angiogenesis, inflammation, stromal remodeling). This combined “cell–microenvironment” regulation has not been reported in lung cancer, HCC, or related cancers. The finding highlights AGAP11’s functional diversity and the novelty of our work in TNBC, providing new insights into its pathogenesis.
This study used a single source of samples, which may be constrained by the high homogeneity of patient baseline characteristics—including age distribution and comorbidity status—and standardized diagnostic and treatment protocols—such as surgical standards and postoperative follow-up criteria—coupled with inherent limitations related to regional population demographics. This design could introduce potential biases, including selection bias and geographic bias, representing the primary limitations of the present study: the findings may be most applicable to populations with characteristics similar to those in our cohort, and direct generalization to TNBC patients in different regions, healthcare settings, or under divergent treatment models remains challenging, thereby compromising the external validity of the conclusions. To mitigate these limitations, we plan to collaborate with multicenter research teams across diverse geographic and institutional settings to expand the sample size and incorporate heterogeneous patient populations, encompassing variations in age, comorbidity profiles, and therapeutic approaches. By harmonizing data collection protocols and analytical methods, adjusting for baseline confounders, and minimizing biases associated with single-center design, we aim to more robustly validate the clinical significance and regulatory role of AGAP11 in TNBC, thus enhancing the generalizability and clinical translational potential of our findings. Furthermore, the study has yet to validate the regulatory role of AGAP11 through in vivo experiments, and the exploration of downstream target genes and related signaling pathways of the AGAP11/miRNA-1269a axis requires further investigation. Future research will also integrate transcriptomic sequencing technology with animal models to refine the regulatory network.

Conclusion
In summary, this study identifies AGAP11 as a potential molecular biomarker for assessing the clinical prognosis of TNBC and the supplementary indicator for clinical risk stratification. AGAP11 modulates the malignant behavior of TNBC cells and the tumor microenvironment through the AGAP11/miR-1269a axis, thereby inhibiting the malignant progression of TNBC. These findings lay the groundwork for precision prognosis stratification and the development of targeted therapeutic strategies for TNBC.

Supplementary Information
Below is the link to the electronic supplementary material.