본문으로 건너뛰기
← 뒤로

MAGEA11 promotes GC proliferation, migration, and invasion through activation of E2F1 transcriptional activity.

1/5 보강
Scientific reports 📖 저널 OA 97.8% 2021: 24/24 OA 2022: 32/32 OA 2023: 45/45 OA 2024: 140/140 OA 2025: 938/938 OA 2026: 719/767 OA 2021~2026 2025 Vol.15(1) p. 41416
Retraction 확인
출처

Shen Q, Lu Z, Dai L, Huang X, Feng Y

📝 환자 설명용 한 줄

Gastric cancer (GC) is a prevalent gastrointestinal malignancy in China.

이 논문을 인용하기

↓ .bib ↓ .ris
APA Shen Q, Lu Z, et al. (2025). MAGEA11 promotes GC proliferation, migration, and invasion through activation of E2F1 transcriptional activity.. Scientific reports, 15(1), 41416. https://doi.org/10.1038/s41598-025-25392-8
MLA Shen Q, et al.. "MAGEA11 promotes GC proliferation, migration, and invasion through activation of E2F1 transcriptional activity.." Scientific reports, vol. 15, no. 1, 2025, pp. 41416.
PMID 41272195 ↗

Abstract

Gastric cancer (GC) is a prevalent gastrointestinal malignancy in China. Despite advancements in multidisciplinary diagnosis and treatment strategies, the 5-year survival rate remains low at just 10-20%. A significant number of patients ultimately die from postoperative recurrence and distant metastasis. Therefore, it is crucial to investigate the core mechanisms underlying GC development and progression and to identify potential molecular targets for early diagnosis, prevention, and treatment. MAGEA11, part of the melanoma-associated antigen (MAGE) gene family, is associated with several cancers. However, its expression, function, and mechanisms in GC remain unclear. In this study, we first confirmed that MAGEA11 is highly expressed in GC through data analysis from The Cancer Genome Atlas (TCGA), univariate and multivariate Cox regression analyses, and Kaplan-Meier survival curve analysis. Our findings indicate that MAGEA11 is an independent prognostic factor for overall survival (OS) in GC patients, with higher expression levels correlating with shorter OS, disease-specific survival (DSS), disease-free interval (DFI), and progression-free interval (PFI). Next, we explored the role of MAGEA11 in GC by constructing stable cell models with MAGEA11 knockdown and overexpression. Functional assays on these models demonstrated that MAGEA11 promotes the proliferation, migration, and invasion of GC cells in vitro. Additionally, the tumor-promoting effects of MAGEA11 were verified in vivo using a GC cell tumor model. Previous studies have shown that MAGEA11 increases the transcriptional activity of the transcription factor E2F1, thereby promoting cancer progression. To verify this mechanism in GC, we conducted cell function experiments and immunohistochemistry, confirming that MAGEA11 promotes GC development by activating E2F1's transcriptional activity. These findings indicate that MAGEA11 may be a useful molecular marker for predicting GC prognosis.

🏷️ 키워드 / MeSH 📖 같은 키워드 OA만

같은 제1저자의 인용 많은 논문 (3)

📖 전문 본문 읽기 PMC JATS · ~37 KB · 영문

Introduction

Introduction
Gastric cancer (GC) is a prevalent gastrointestinal cancer globally, especially in China, where it has one of the highest incidence rates.1. Early-stage GC typically lacks noticeable symptoms, and more than 80% of newly diagnosed cases are already in advanced stages. Consequently, surgery alone often fails to achieve optimal outcomes2. Even with multidisciplinary clinical approaches, The 5-year survival rate for GC patients is still low, at 10–20%, with most deaths resulting from postoperative recurrence or distant metastasis3. Thus, identifying novel molecular targets is essential for improving early diagnosis, prevention, and treatment strategies.
The MAGE gene family consists of highly conserved genes that play critical roles in embryonic development4. In adults, MAGE family members are expressed in a few tissues, including the testis, ovaries, gastrointestinal tract, brain, lungs, and skin. The MAGE family is categorized into two subfamilies, MAGE-I and MAGE-II, based on differences in tissue-specific expression and gene structure. The MAGE-I subfamily, which includes MAGE-A, MAGE-B, and MAGE-C, is highly expressed in various cancerous tissues, including those of breast, prostate, melanoma, lung, and colorectal cancers5–9, and plays a significant role in tumor development10,11.
MAGEA11, a MAGE-I subfamily member, belongs to the carcinoembryonic antigen gene family. The protein encoded by MAGEA11 shares substantial similarities with other MAGE family members. Research indicates that MAGEA11 is highly expressed in several tumor types, including breast cancer12 and prostate cancer13. Additionally, high MAGEA11 expression is linked to tumor differentiation, invasion depth, and prognosis.
Research has shown that MAGEA11 can influence tumor cell proliferation, apoptosis, invasion, and metastasis through several pathways. For instance, MAGEA11 promotes the proliferation and apoptosis resistance of breast cancer cells14. Additionally, MAGEA11 regulates tumor cell migration and invasion, thereby contributing to tumor metastasis. These findings suggest that MAGEA11 may serve as a potential therapeutic target to address the occurrence and progression of cancer. Although previous studies have demonstrated that MAGEA11 promotes GC cell proliferation and migration15, the specific mechanisms behind its high expression in GC have yet to be explored. This article explores the expression patterns and potential mechanisms of MAGEA11 in GC.

Materials and methods

Materials and methods

Data acquisition and processing
Gene expression, mutation, and clinical data were obtained from TCGA (https://portal.gdc.cancer.gov/). Pan-cancer datasets were analyzed, with the TCGA-STAD cohort specifically used for gastric cancer (GC). Expression matrices were normalized, log2-transformed, and low-abundance genes removed using R packages. Differentially expressed genes were identified with DESeq2 (|log2FC|≥ 1, FDR < 0.05). For pan-cancer analysis, MAGEA11 expression was compared between tumor and normal tissues across cancer types using the Wilcoxon rank-sum test with FDR correction.

Cell culture
GeneChem (Shanghai, China) provided GC cell lines AGS, MKN-45, SGC-7901, BGC-823, and HGC-27, as well as the control GES-1 gastric mucosa cell line. A humidified incubator with 5% CO2 was used to culture the cells at 37 °C in RPMI-1640 medium containing 10% fetal bovine serum (FBS).

Cell transfection
Cells in 6-well plates were transfected with MAGEA11-specific siRNA or control constructs using Lipofectamine 3000 (Invitrogen, USA), with constructs sourced from GeneChem, Shanghai, China. The sequences were as follows:
MAGEA11-siRNA sense,5′-GAGGCAGCACUUCCAGUCAACA-3′; antisense,5′-UUGACUGGAAGUGCUGCCUCUC-3′. E2F1-siRNA sense,5′-GAUGGUAUGGUGAUCAAAGC-3′; antisense, 5′-UUUGAUCACCAUAUACCAUC-3′. After 48 h of transfection, the cells were collected for functional assays, with all analyses repeated three times. For gene overexpression, human MAGEA11 and E2F1 coding sequences were cloned into the pCDH-CMV-MCS-EF1-copGFP-T2A-Puro lentiviral backbone (System Biosciences), generating pCDH-MAGEA11 and pCDH-E2F1 constructs with copGFP as a reporter and puromycin resistance for selection. The MAGEA11 overexpression plasmid was custom-designed by GenePharma (Shanghai).

Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted using TRIzol reagent (Invitrogen, USA). Complementary DNA (cDNA) was synthesized in a 20 μl reaction volume with the HiScript III RT SuperMix for qPCR (+ gDNA wiper) kit (Vazyme, Nanjing, China), according to the manufacturer’s instructions. RT-qPCR was then performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, New Jersey, USA) on the QuantStudio 5 Real-Time PCR System (ABI, USA). GAPDH was used as the internal control, and relative gene expression levels were calculated using the 2^–ΔΔCt method. All experiments were conducted in triplicate. The following primers were used: MAGEA11:F-AGTACCTCGCCTGACCTGAT; R-GACTCGATACTTGCGGGAGCA; GAPDH: F-AGAAGGCTGGGGGCTCATTTG; R-AGGGGCCATCCACAGTCTTC. E2F1: F- AAACAAGGCCCGATCGATGT; R- TGGGATCTGTGGTGAGGGAT.

Western blotting
Western blotting was performed as previously described. Briefly, equal amounts of protein lysates were separated by SDS-PAGE and transferred onto PVDF membranes (Millipore, USA). After blocking with 5% non-fat milk in TBST, membranes were incubated overnight at 4 °C with the following primary antibodies (all purchased from Wuhan Sanying Biotechnology, China): anti-MAGEA11 polyclonal antibody (Cat. No. 15474–1-AP, rabbit, 1:500–1:1000), anti-E2F1 polyclonal antibody (Cat. No. 12171–1-AP, rabbit, 1:500–1:2000), and anti-GAPDH polyclonal antibody (Cat. No. 10494–1-AP, rabbit, 1:5000–1:40,000). GAPDH served as a loading control. After washing, membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibody (1:5000, Jackson ImmunoResearch, USA) for 1 h at room temperature. Protein bands were visualized using enhanced chemiluminescence (ECL; Thermo Fisher Scientific, USA) and imaged with a ChemiDoc imaging system (Bio-Rad, USA).

Immunohistochemistry (IHC)
Immunohistochemistry (IHC) was performed on paraffin-embedded tissue sections. The following primary antibodies were used: anti-E2F1 polyclonal antibody (Cat. No. 12171–1-AP, Proteintech, rabbit, 1:50–1:200) and anti-MAGEA11 polyclonal antibody (bs-6817R, Bioss, rabbit, 1:100–1:500). Antibodies against Ki67 and Cleaved-Caspase-3, as well as the HRP-conjugated secondary antibodies, were obtained from Servicebio (Wuhan, China). The IHC procedure included baking at 60 °C for 120 min, deparaffinization and rehydration through graded ethanol, endogenous peroxidase blocking with 3% H₂O₂, antigen retrieval in citrate buffer (microwave, 98–100 °C), blocking with 5% BSA, overnight incubation with primary antibodies at 4 °C, followed by secondary antibody incubation at 37 °C. Staining was developed using DAB, counterstained with hematoxylin, and sealed with neutral gum for microscopic evaluation.

EdU and colony formation assay
The Click-iT EdU Imaging Kit (Beyotime, Beijing, China) was used to measure the DNA synthesis rate, following the manufacturer’s instructions. After transfecting HGC-27 or AGS cells with small interfering RNA or overexpression plasmid, the cells were collected, digested, and resuspended. Six-well plates were plated with 2 mL of cell suspension seeded at 500 cells/mL. After ten days of culture with medium changes every three days, colonies with over 50 cells were fixed with 4% paraformaldehyde and stained with Giemsa crystal violet. Images were captured using an Olympus fluorescence microscope (Tokyo, Japan).

Wound healing assay
The HGC-27 and AGS cells were transfected with small interfering RNA or overexpression plasmids and plated in 6-well plates. Scratches were made, and the plates were washed three times with PBS. Images were captured at 12 and 24 h after incubation in serum-free medium, and migration rates were quantified using ImageJ.

Transwell assay
An upper chamber was added 200 L of culture medium without FBS, while a lower chamber was added 600 L of culture medium containing 30% FBS as a chemoattractant. Cells that migrated through the membrane after 48 h of incubation were stained with crystal violet. Cells that did not migrate through the membrane were discarded. An Olympus fluorescence microscope (Tokyo, Japan) was used for imaging and cell counting.

Animal experiments
Six-week-old female BALB/c nude mice were obtained from the Animal Experiment Center at Nantong University (Nantong, China). All procedures involving animals were approved by the Institutional Animal Care and Use Committee of Nantong University, in accordance with current animal welfare guidelines. Lentiviruses (si-MAGEA11 and OE-MAGEA11) were sourced from RiboBio (Guangzhou, China) to infect HGC-27 and AGS GC cells for the xenograft model. Each mouse received a subcutaneous injection of 5 million cells. Tumor volumes were assessed every three days using the formula V = 0.5 × length × width2. In accordance with the ARRIVE guidelines, the maximum tumor volume permitted was 1,500 mm3, and the tumor weight should not exceed 10% of the animal’s body weight. After a period of 28 days, the mice were euthanized, and the tumors were excised for subsequent analysis and weighed. All mice were euthanized using isoflurane anesthesia and subsequent carbon dioxide asphyxiation. Carcasses were then placed in white sealing bags and transported to the Nantong University Laboratory Animal Center for centralized, safe disposal. Ethics Approval Number: S20210225-009.

Co-immunoprecipitation (Co-IP) assay
Cells were lysed in IP lysis/wash buffer provided in the Pierce™ Classic Magnetic Bead Assay IP/Co-IP kit (Thermo Fisher, USA) for 10 min. Following lysis, the samples were centrifuged at 13,000g for 10 min at 4°C. The supernatant was incubated overnight at 4°C with 2 μg of anti-MAGEA11 antibody, and then mixed with 25μL of Protein A/G magnetic beads for 1 h at room temperature. After washing, 100 μL of elution buffer was added, and the mixture was incubated for 10 min. The supernatant containing the target antigen was neutralized, combined with 25μL of loading buffer, and heated for 5 min. The proteins that bound were detected using Western blotting. MAGEA11 MaxPab rabbit polyclonal antibody (Cat No. H00004110-D01, Abnova, Rabbit, dilution 1:500–1:1000) was used for Co-IP.

Clinical samples
A total of ninety-eight paired samples of tumor and adjacent non-tumor tissues were collected from GC patients who had not undergone any antitumor therapy before surgery. These samples were gathered at Nantong University Hospital between January and December 2010, with follow-up concluding in August 2015. Ten pairs of fresh samples were selected for qPCR. All patients provided informed consent. Ethical approval number: 2023-K076-01.

Statistical analysis
To determine independent predictors of OS in GC patients, univariate and multivariate Cox regression analyses were performed. The variables analyzed included pathologic stage, T-stage, N-stage, M-stage, and MAGEA11 expression. Data are expressed as mean ± standard deviation (SD), with all experiments performed in triplicate. Statistical analyses were conducted using GraphPad Prism 7.0, R (version 4.1.2), or SPSS (version 22.0). A p-value of less than 0.05 was considered significant, denoted as: ns (not significant), *P < 0.05, **P < 0.01, ***P < 0.001.

Results

Results

MAGEA11 expression is upregulated in GC tissues and correlates with prognosis
Through analysis of The Cancer Genome Atlas (TCGA) database, we found that MAGEA11 expression was significantly upregulated in various cancers, including gastric cancer (GC), lung squamous cell carcinoma, esophageal cancer, head and neck squamous cell carcinoma, uterine carcinosarcoma, and cystourethral epithelial tumors (Fig. 1A). Cox univariate analysis revealed that MAGEA11 expression was statistically significant only in GC (Fig. 1B). Multifactorial Cox regression analysis showed that MAGEA11, along with T/N staging, was an independent prognostic factor for overall survival (OS) in GC patients (Fig. 1C). Kaplan–Meier survival curves indicated that higher MAGEA11 expression was associated with shorter Overall Survival (OS) , Disease-Specific Surviva (DSS) , Disease-Free Interval (DFI) , and Progression-Free Interval (PFI) (Fig. 1D–G).

MAGEA11 expression is significantly elevated in GC cells compared to normal gastric epithelial cells
Ten paired fresh tumor tissues and adjacent normal tissues were collected from gastric cancer patients at the Affiliated Hospital of Nantong University. Through qPCR experiments, we observed that MAGEA11 was significantly upregulated at the mRNA level in gastric cancer tissues(Fig. 2A). The expression of MAGEA11 in GC cell lines and the normal gastric epithelial cell line GES-1 was analyzed using qPCR and Western blot (WB). GC cell lines (HGC-27, MKN-45, SGC-7901, BGC-823, and AGS) exhibited significantly higher MAGEA11 expression at the mRNA levels compared to GES-1. However, at the protein expression level, AGS and BGC-823 did not show a marked difference compared with GES-1 (Fig. 2B–C and S1A). In summary, among the GC cell lines, MAGEA11 expression was highest in HGC-27 cells and lowest in AGS cells. To investigate the role of MAGEA11 in GC, we constructed stable MAGEA11 knockdown models in HGC-27 cells using small interfering RNA and overexpression models in AGS cells using an overexpression plasmid. qPCR and WB confirmed the efficiency of knockdown and overexpression (Fig. 2D–G and S1B–C).

MAGEA11 regulates GC cell proliferation, migration, and invasion in vitro
Transwell assays (Fig. 3A–B and S2A–D) demonstrated that MAGEA11 knockdown inhibited the migratory and invasive abilities of GC cells, while overexpression of MAGEA11 promoted migration and invasion. A wound healing assay confirmed that MAGEA11 affects GC cell migration (Fig. 3C and S2E–F). The EdU proliferation assay (Fig. 3D) and colony formation assay (Fig. 3E and S2G–H) indicated that MAGEA11 knockdown reduced GC cell proliferation, while overexpression increased it.

MAGEA11 affects tumor growth in nude mice
Nude mice received subcutaneous injections of HGC-27 cells transfected with either negative control or MAGEA11 knockdown constructs. After 28 days, tumors were excised, revealing that tumors derived from MAGEA11-knockdown cells grew significantly slower, with smaller tumor weights and volumes compared to the control group (Fig. 4A–C). Similarly, AGS cells transfected with negative control or MAGEA11 overexpression constructs were injected into nude mice, and after 28 days, tumors from the MAGEA11-overexpressing group grew significantly faster, with larger weights and volumes than the control group (Fig. 4D–E). Immunohistochemical (IHC) analysis showed a lower Ki-67 index and higher Cleaved-Caspase-3 expression in the knockdown group, while the opposite was observed in the overexpression group (Fig. 4F and S5A). These findings confirm that MAGEA11 promotes tumor growth in vivo.

MAGEA11 enhances E2F1 transcriptional activity, while E2F1 mitigates MAGEA11’s influence on GC cell proliferation, migration, and invasion
Previous studies have shown that MAGEA11 increases the transcriptional activity of E2F1 by interacting with its active hypophosphorylated form, likely enhancing E2F1’s interaction with chromatin16. Using R for analysis and visualization, we found a correlation between MAGEA11 and E2F1 expression (Fig. 5A). STRING and GeneMANIA databases were used to construct a protein–protein interaction (PPI) network, revealing an interaction between MAGEA11 and E2F1 (Fig. 5B–C). Co-immunoprecipitation (Co-IP) assays further confirmed this interaction in GC cells (Fig. 5D). Based on this phenomenon, we hypothesized that MAGEA11 could transcriptionally activate E2F1. To test this hypothesis, we analyzed the E2F1 promoter and identified potential MAGEA11 binding sites (Fig. 5E). We then constructed vectors containing either the wild-type or mutant E2F1 promoter for luciferase reporter assays (Fig. 5F). Our results showed that transfection of MAGEA11 significantly enhanced the luciferase activity of the E2F1 WT reporter, whereas the MUT reporter completely abolished this effect, indicating that this site is a critical region for MAGEA11-mediated upregulation of E2F1 (Fig. 5G). Next, we first verified the transfection efficiency of E2F1 using siRNA-mediated knockdown and overexpression plasmids by qPCR (Fig. 5H–I). Then, In HGC-27 cells, MAGEA11 knockdown led to a decrease in E2F1 expression, as verified by qPCR and WB (Fig. 5J, L and S1D). Conversely, overexpression of MAGEA11 upregulated E2F1 expression (Fig. 5K, M and S1E).

Next, we first verified the proliferative, migratory, and invasive abilities of E2F1 in gastric cancer cells using transwell (Fig. S3A–B, D–E) and colony formation assays (Fig. S3C, F). To explore the functional relationship between MAGEA11 and E2F1 in GC, we transfected HGC-27 cells with constructs for the negative control, MAGEA11 knockdown, and simultaneous MAGEA11 knockdown with E2F1 overexpression. At the same time, AGS cells were transfected with constructs for the negative control, MAGEA11 overexpression, and simultaneous MAGEA11 overexpression with E2F1 knockdown. Cloning and EdU assays showed that E2F1 could antagonize the effects of MAGEA11 on GC cell proliferation and colony formation (Fig. 6A–B, F and S4A-B). Transwell and wound healing assays also demonstrated that E2F1 antagonizes MAGEA11’s effects on migration and invasion (Fig. 6C–E and S4C–H).

MAGEA11 and E2F1 are highly expressed in GC tissues and correlate with poor prognostic outcomes
Immunohistochemical analysis of clinical specimens revealed that MAGEA11 and E2F1 are highly expressed in GC tissues, as shown by representative images (Fig. 7A). Tissue microarray analysis showed that MAGEA11 and E2F1 were significantly upregulated in tumor tissues versus normal tissues (Fig. 7B). Expression scoring of tissue samples based on staining intensity further confirmed that both MAGEA11 and E2F1 were significantly elevated in GC tissues (Fig. 7C–D). Correlation analysis demonstrated a positive relationship between MAGEA11 and E2F1 expression (Fig. 7E). Kaplan–Meier analysis showed that higher MAGEA11 and E2F1 expression levels were linked to worse patient prognosis (Fig. 7F–H). These findings suggest that the co-expression of MAGEA11 and E2F1 contributes to GC progression and highlights their potential as therapeutic targets for precision medicine in GC.

Discussion

Discussion
GC is among the deadliest gastrointestinal tumors globally. While surgical intervention remains the most effective treatment for early-stage GC, it becomes less viable as the disease progresses, particularly for advanced tumors. As a result, chemotherapy has become the standard treatment for advanced GC17,18. Identifying new molecular targets for early diagnosis and prevention, as well as enhancing the efficacy of late-stage chemotherapy, is critical for improving GC prognosis. Recent advancements in molecular biology and gene technology have opened new avenues for precision treatment in GC. For example, Lin et al. demonstrated that CHPF expression is upregulated in GC tissues, promoting proliferation, colony formation, and migration while inhibiting apoptosis by regulating E2F119. Similarly, Huang et al. showed that targeting CHSY3 expression, combined with anti-PD-L1 therapy, significantly inhibited tumor growth by regulating GC cell proliferation, migration, and invasion20.
MAGEA11, a member of the carcinoembryonic antigen family, functions as an androgen receptor (AR) coactivator and proto-oncogene21. Numerous studies have reported its aberrant expression in various tumor types. For instance, John et al. revealed that elevated MAGEA11 levels are involved in AR transactivation and contribute to the progression of prostate cancer, potentially driving androgen therapy resistance through ligand-independent AR activity22. Moreover, MAGEA11 expression predicts patient prognosis in head and neck squamous cell carcinoma and has been implicated in cisplatin resistance in head and neck cancers23,24. Although MAGEA11 has been well-documented in various cancers, its role in GC remains underexplored, suggesting It may be a target for the treatment of GC.
In this study, we explored MAGEA11 expression and its prognostic relevance in GC. Analysis of the TCGA database revealed that MAGEA11 is significantly upregulated in various cancer types, including squamous cell carcinoma of the lung, head, neck, and esophagus, uterine carcinosarcoma, bladder uroepithelial tumors, and GC. However, Cox univariate analysis revealed that high MAGEA11 expression was linked to poor prognosis solely in GC. Multifactorial Cox regression analysis confirmed that MAGEA11 is an independent prognostic factor for overall survival (OS) in GC patients, supported by Kaplan–Meier survival analysis. In vitro experiments showed that MAGEA11 knockdown and overexpression significantly affected the proliferation, migration, invasion, and colony formation of GC cells, indicating its role in promoting tumor growth and metastasis. Furthermore, in vivo studies confirmed that MAGEA11 is crucial for the growth of GC xenograft tumors.
E2F1 is a transcription factor involved in regulating the cell cycle and apoptosis, controlling the expression of cytokines and growth factor receptors through feedback mechanisms25. It is essential for several cellular processes, such as cell cycle progression, DNA replication, repair, differentiation, and apoptosis26. Previous studies have highlighted the significance of E2F1 in various cancers, including renal cancer27, ovarian cancer28, colorectal cancer29, and glioma30. For instance, Florian et al. showed that E2F1 is highly expressed in melanoma, and inhibiting its activity increased melanoma cell death and senescence both in vitro and in vivo31.
Recent studies have increasingly explored the role of E2F1 in GC. Gao et al. described a dual negative feedback loop between E2F1 and miR-532, emphasizing their roles in GC cell proliferation, G1/S transition, DNA damage, and apoptosis32. Additionally, Xu et al. found that E2F1 induced TINCR transcriptional activity and accelerated GC progression via the TINCR/STAU1/CDKN2B signaling axis33.
To investigate whether MAGEA11 and E2F1 have a synergistic role in GC progression, we reviewed relevant literature. MAGEA11 interacts with retinoblastoma-associated protein p107, releasing transcriptionally active E2F1. Furthermore, MAGEA11’s interaction with hypophosphorylated E2F1 is consistent with the release of hyperphosphorylated E2F1, which is required to increase E2F1 transcriptional activity16. Additionally, MAGEA11 can inactivate S-phase kinase-associated protein Skp2, stabilizing E2F1 through the formation of an E2F1-MAGEA11-Skp2 complex34. Elevated MAGEA11 levels have been shown to enhance both AR and E2F1 transcriptional activity, promoting prostate cancer development21. Based on these insights, we hypothesized that MAGEA11 regulates GC development by activating E2F1 transcription.
To test this hypothesis, we first demonstrated the interaction between MAGEA11 and E2F1 using the STRING and GeneMANIA databases as well as co-IP assays. We then analyzed the E2F1 promoter using the JASPAR database to identify potential MAGEA11 binding sites, followed by luciferase reporter assays to assess the effect of MAGEA11 on the E2F1 promoter. Subsequent studies confirmed that MAGEA11 knockdown or overexpression significantly altered E2F1 expression in GC cells, with MAGEA11 upregulation leading to increased E2F1 expression and MAGEA11 knockdown causing a reduction. Additionally, E2F1 antagonized the effects of MAGEA11 on GC cell proliferation, migration, and invasion. Finally, immunohistochemistry analysis of 98 paired tumor and adjacent non-tumor tissue samples from GC patients revealed that both MAGEA11 and E2F1 were significantly elevated in GC tissues and linked to worse prognosis. These findings indicate that MAGEA11 promotes GC proliferation, migration, and invasion by activating E2F1 transcriptional activity.
The potential therapeutic role of MAGEA11 has attracted considerable attention, and targeting MAGEA11 could become a novel strategy for treating certain malignancies. For instance, researchers are investigating the efficacy and safety of MAGEA11-targeted immunotherapy. Additionally, several drug molecules that inhibit MAGEA11 expression and activity are being explored as potential treatments for tumors35.
In summary, this study highlights MAGEA11’s role in GC development and provides a theoretical foundation for future therapeutic strategies targeting MAGEA11. However, this study has certain limitations. We lack in vivo experiments to confirm E2F1’s role as a key downstream mediator of MAGEA11 function, and the precise mechanism by which MAGEA11 binding directly regulates E2F1 protein levels remains unclear. To address these gaps, we are currently conducting follow-up experiments. For example, in a mouse model overexpressing MAGEA11, we will simultaneously knock down E2F1 to observe changes in tumor growth; conversely, in a MAGEA11 knockdown model, we will restore E2F1 expression to determine whether this “rescues” the tumor-suppressive effect caused by MAGEA11 loss. In addition, we are performing cycloheximide chase assays and ubiquitination analyses to elucidate the direct regulatory mechanism by which MAGEA11 binding affects E2F1 protein stability. Through continued research, we hope to develop new, more effective strategies for precision cancer therapy.

Supplementary Information

Supplementary Information
Below is the link to the electronic supplementary material.

출처: PubMed Central (JATS). 라이선스는 원 publisher 정책을 따릅니다 — 인용 시 원문을 표기해 주세요.

🏷️ 같은 키워드 · 무료전문 — 이 논문 MeSH/keyword 기반

🟢 PMC 전문 열기