High Prevalence of Active HDV Infection Among HBsAg-Positive Patients in Urban and Rural Areas in Gabon: A Cross-Sectional Retrospective Study.

1
Introduction
Hepatitis delta virus is a defective virus, also called the satellite virus of the hepatitis B virus, because it is a virus that requires the hepatitis B antigen for its assembly. These two viruses are responsible for severe inflammatory hepatic infection. According to the World Health Organisation, the global prevalence of HDV infection is around 5% among people who have a chronic infection with the hepatitis B virus (HBV) [1]. The severity of HDV and HBV coinfection is sustained by a rapid progression toward liver‐related death and hepatocellular carcinoma [2, 3, 4, 5]. According to the WHO, chronic viral hepatitis affects over 70 million Africans (60 million with hepatitis B and 10 million with hepatitis C). This continent registers 200,000 deaths a year due to a lack of care despite the availability of diagnostic tools and effective treatment for hepatitis B and C, respectively [6]. Patients with positive HDV antibodies show a range of 34% to 70% for positive HDV RNA by PCR [4, 7, 8, 9], indicating a high prevalence of HDV replicative forms. The HDV worldwide distribution suggests an intense circulation of HDV‐I, V, VI, VII, and VIII in Africa, particularly Central Africa [8, 10]. In Gabon, some studies show a high prevalence of HDV in rural areas (63%), urban areas (70.6%), and among pregnant women (15.6%) [11, 12]. A more recent study highlights a global HBsAg prevalence of 7.6% around the nine provinces of Gabon, with a serological signature of HDV among HBsAg‐positive patients of 27.7%. The high rate of HDV seroprevalence was registered in the North (Woleu‐Ntem). In the Haut‐Ogooué province, the prevalence of HDV was low (16%) compared to Estuaire province (26.9%) [13]. This study aims to investigate the serological and molecular signature of HDV among HBsAg‐positive patients who come for their routine analysis in the CIRMF Laboratories (Haut‐Ogooué and Estuaire provinces).

2
Materials and Methods
2.1
Study Sites and Sampling
We implemented the study at the Laboratoire d'Analyses Médicales (LAM) of Centre Interdisciplinaire de Recherches Médicales de Franceville (CIRMF) and the Unité Mixte de Recherche entre le CIRMF et le service de Santé Militaire (UMR CIRMF‐SSM). These centres are located in semi‐urban (LAM‐CIRMF, Franceville, Haut‐Ogooué Province) and urban (UMR CIRMF‐SSM, Libreville, capital of Gabon, Estuaire province) cities of Gabon (Figure 1).
All participants were received at the medical unit (LAM) of the CIRMF (from April 1st, 2019, to December 30th, 2022 and the UMR CIRMF‐SSM (From January 2nd to June 30th, 2023), where they came to take the result of the routine HBsAg screening. As is generally the case in central Africa, when a patient come for infectious diseases suspicion, HBsAg, HIV, and Malaria tests are generally requested by the clinician. Inclusion criteria were as follows: being diagnosed HBsAg positive and providing informed consent to participate in the study. Minimal demographic information, including age and sex, was collected during the study period.

2.2
Sample Pre‐Analytic Treatment
All plasma was treated before being stored as follows: blood tubes containing EDTA anticoagulant were centrifuged at 3000 rpm/min (1500 x G) for 10 min, and then plasma was separated from the buffy coat and stored in a 1.8 ml cryotube at −80°C in the biobank of the medical analysis research unit of CIRMF LAM and UMR CIRMF‐SSM.

2.3
Serological Tests
For the HBsAg test, we use the Vidas HBsAg enzyme‐linked fluorescent assay (bioMérieux, Marcy‐l’Étoile, France). The serological test targets IgG antibodies against the hepatitis D virus (anti‐HDV). The serological diagnosis of hepatitis D virus was performed with a third‐generation ELISA kit (Biorbyt Ltd, Cambridge, CB4 0WY, UK), according to the manufacturer's instructions.

2.4
Molecular Tests
2.4.1
RNA Extraction
Viral RNA was extracted from 200 µL of plasma from all HDVAb‐positive samples using the NucleoMag Pathogen kit for viral and bacterial RNA/DNA from clinical samples (MACHEREY889 ‐NAGEL; Dueren, Germany) according to the manufacturer's instructions. The final elution volume was 50 µL. Samples were stored at −20°C.

2.4.2
PCR Amplification
The PCR was performed to amplify the R0 region of HDV, a 400‐base pair (bp) fragment ranging from position 889 to 1289, using pan‐genotype primers 889 s (5’‐CATGCCGACCCGAAGAGGAAAG‐3’) and 1289as (5’‐GAAGGAAAGGCCCTCGAGAACAAGA‐3’), as previously described [14]. Briefly, 5 µL of extracted RNA was used to amplify the R0 region with the Superscript IV Reverse Transcriptase kit (Invitrogen; Life Technologies Ltd, UK), following the manufacturer's recommendations. The reverse transcription PCR (RT‐PCR) was carried out in a thermocycler (GeneAmp PCR System 9700; Applied Biosystems) under the following conditions: 30 min at 45°C and 2 min at 94°C, followed by 40 cycles of 15 s at 94°C, 30 s at 53°C, and 60 s at 68°C, with a final extension step of 300 s at 68°C.

2.5
Statistical Analysis
Statistical analyses were performed using R v4.2.1 software. Numerical variables were presented using means and standard deviations when their distribution was Gaussian or using their median and 25%–75% inter‐quartile range in case of non‐Gaussian distribution. Accordingly, groups were compared either using the Student's t or the Mann‐Whitney U tests. Categorical variables were presented as percentages and analysed by Fisher's exact test when two groups were compared, or by Chi‐Square tests when more than two groups were under scrutiny. All the tests were two‐sided, and the level of significance was set at p < 0.05.

2.6
Sequencing Method and Phylogenetic Analysis
After RT‐PCR amplification of the target fragment, purified amplicons were submitted to Macrogen In (Amsterdam, The Netherlands) for Sanger Sequencing. The resulting chromatogram files (AB1 format) were quality‐checked and edited using MEGA version 10 software to remove ambiguous base calls and ensure accuracy. Cleaned sequences, showing correct quality, that is, those with correct chromatographic peaks, without background interference, were aligned using the ClustalW algorithm implemented in MEGA 10. Multisequence alignment was manually inspected and adjusted where necessary to optimize homology. Phylogenetic relationships were inferred using the Maximum likelihood method with 1,000 bootstrap replicates to assess branch support. All evolutionary analyses were conducted within the MEGA 10 software.

2.7
Ethical Statement
This study followed the local legislation and institutional requirements. All participants freely gave their written consent. For patients recruited retrospectively (before 2022), all personnel data (names) were fully anonymised before being included in the database. This study on viral hepatitis was approved by the Gabon National Ethic Committee for Research under the following number: PROT N°0011/2013/SG/CNE.

3
Results
3.1
Cohort Socio‐Demographic Characteristics of the HDV Seropositive Population
We recruited 145 HBsAg‐positive patients in Libreville and Franceville. More specifically, 44 HBsAg‐positive patients out of 628 tested were detected in Franceville (7.0%), while among the 1542 patients tested in Libreville, 101 were positive (6.5%) (Figure 2). HBsAg prevalence was not significantly different in the two recruitment centres (p = 0.70). The sex ratio (M: F) of HBsAg‐positive individuals was 2.6 (105:40), and the mean age of this population was 40 ± 9.8 years. The age of these patients ranged between 20 and 72.

3.2
Serological Analysis
Out of the 145 HBsAg‐positive patients tested for IgG anti‐HDV antibodies by ELISA, 38 were positive, giving an overall prevalence of 26.2% (95%CI: 19; 33.4). This prevalence was 23.8% (n = 25/105) in men and 32.5% (n = 13/40) in women. The M:F sex ratio of anti‐HDV positive patients was 1.9 (25:13), thus lower than for HBsAg alone. The mean age of these HDV‐infected patients was 41 ± 10.3 years. Regarding area, the prevalence in Libreville was drastically higher than in Franceville, 40.9% (n = 18/44) versus 19.8% (n = 20/101), respectively (Table 1). The age category most affected was the 35–50 years group, with a prevalence of 28.3% (n = 17/60).

3.3
Molecular Analysis
Of the 38 ELISA‐positive patients, 34 underwent RT‐PCR testing (four samples had no plasma remaining). A subset of ten patients (29.4%, n = 10/34) tested positive by PCR, and their amplification products were sequenced. Six were from Franceville, and four from Libreville (Table 2).
Of the six sequences from Franceville, two could not be employed for phylogenetic analysis due to their poor quality. The four sequences of correct quality were found to be close to genotype I (one patient) and genotype VIII (three patients). For the Libreville samples, three sequences were of correct quality; of these, two were close to genotype VII and one to genotype VIII (Figure 3). All genotype VIII sequences were close to sub‐genotype VIII‐a.

4
Discussion
This study focuses on the prevalence and circulating strains of HDV in Gabon's semi‐urban (Franceville) and urban (Libreville) populations, spread 500 km apart in the Eastern Forest part and on the Western Atlantic coast of the country, respectively. HDV infection has a significant influence on the course of the liver disease, generally increasing its severity [15, 16].
The HBsAg‐positive population was predominantly male. These data are in line with the literature, which shows that patients seeking healthcare in case of HBsAg carriage are twice as likely to be men as women [17, 18]. The average and median ages of HBsAg carriers were 41 and 39 years, respectively, reflecting a stage in sub‐Saharan Africa where the onset of complications occurs, concerning the total duration of infection, generally acquired during infancy. The difference in HBsAg prevalence between the two towns was not significant. The overall prevalence of HBsAg (n = 145/2170, 6.7%) in our survey confirms the position of Gabon in the high‐intermediate HBV endemic area [19].
Hepatitis Delta infection remains understudied in our country and in Central Africa. However, it represents a significant risk of rapid development of liver cirrhosis and hepatocellular carcinoma in coinfected or superinfected patients [3]. Indeed, the occurrence rate of fulminant hepatitis, liver cirrhosis, and hepatocellular carcinoma is higher in HBsAg carriers infected with hepatitis Delta [15]. Gabon, a central African country, has a prevalence of HDV in HBsAg carriers ranging between 15.6% and 44.6% [12, 13, 20]. Our present study reports an overall HDV prevalence of 26.2% but with a wide variation, as patients from Libreville, the national capital located on the Coast of the country, are HDV carriers in 41% of cases, while this rate was only 20% in Franceville, a city located inland in the forest region of Haut‐Ogooué (p < 0.01). These results confirm, nevertheless, that Gabon is a highly endemic country for HDV infection and that the prevalence of the virus follows a north‐to‐south decreasing gradient as suggested by Groc and coworkers [13]. However, when making a balance with urban and rural areas, these results contrast with previous studies, which showed no difference in prevalence between urban (Libreville) and rural (Franceville) areas [20], even if those studies are not directly comparable. The study of Sandrine‐Souquière was performed in the general population, and our present study is focused on patients actively seeking medical consultation. Regarding HDV seroprevalence, we found no statistically significant difference according to age group or sex.
This high level of replicative forms (n = 10/34, 29.4%) underlines the need to accelerate the availability of treatments for hepatitis Delta, given that many patients are unable to control this infection. It is also important to stress that this level of replication is possibly underestimated. The primers used, notably the reverse, would not be strong enough to amplify all genotypes (see supplementary document 1).
This observation emphasizes the need for future treatment, such as pegylated interferon and bulevirtide, as recommended by the conclusion of a study comparing bulevirtide monotherapy versus bulevirtide and pegylated interferon [21]. The commonly available treatment in Africa is pegylated interferon, which is prohibitively expensive for a population that cannot devote large resources to its health. Patients cannot afford treatment in the vast majority of cases. As a result, there has been an exponential increase in the number of people infected with HDV in Gabon in the last decades, explaining the remarkable genetic diversity of viral genotypes (I, V, VI, VII, and VIII) observed in the country, as shown in several previous studies [12, 20, 22]. Our present study merely confirms these data, with the circulation of genotypes I, VII, and VIII.
The limitations of this study consist of the small sample of patients included in Libreville and the lack of relevant clinical and biological data (liver function tests, serological and molecular tests related to HBV infection). Although several studies used the R0 region for genetic diversity assessment, a better characterization of the circulating HDV strains would have been reached with the complete genome sequencing [8, 23]. Another limitation concerns the lack of information on the clinical context in which the Hepatitis B test was carried out.
Infection with HDV has clinical implications that must be correlated with the medical status of the HBsAg carrier [24]. Cross‐cutting concepts, such as the impact or severity of the infection on the patient, depending on the genotype, could be addressed as part of a future broader, more inclusive study integrating different medical disciplines (medicine, biochemistry, virology, imaging, etc.).

Author Contributions
Conceptualisation and Idea development: B.B.M., M.B., P.M.B. Methodology and Design: B.B.M., M.B., P.M.B., E.L.M.M. Data Collection and Experimentation: E.L.M.M., A.G., Y.M.N., D.M.W., L.F.A., J.D.L.Z.O., R.M.B.N. Analysis and Interpretation: E.L.M.M., A.G., Y.M.N., L.F.A. Writing and Drafting: B.B.M., M.B., P.M.B. Supervision and Project Administration: C.B., A.M.O., R.O. Final Approval and Accountability: P.P.

Conflicts of Interest
The authors declare no conflicts of interest.

Supporting information
Supplementary Information