본문으로 건너뛰기
← 뒤로

FBXO39 promotes LDHA-mediated aerobic glycolysis and colorectal cancer progression by p53 degradation.

2/5 보강
Journal of translational medicine 📖 저널 OA 98.9% 2021: 1/1 OA 2022: 1/1 OA 2023: 4/4 OA 2024: 24/24 OA 2025: 173/173 OA 2026: 143/147 OA 2021~2026 2026 Vol.24(1) OA Cancer, Hypoxia, and Metabolism
Retraction 확인
출처
PubMed DOI PMC OpenAlex 마지막 보강 2026-05-01
OpenAlex 토픽 · Cancer, Hypoxia, and Metabolism Autophagy in Disease and Therapy Epigenetics and DNA Methylation

Liu J, Xiao T, Huang J

📝 환자 설명용 한 줄

[BACKGROUND] Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide.

이 논문을 인용하기

↓ .bib ↓ .ris
APA Jipeng Liu, Taifu Xiao, Jun Huang (2026). FBXO39 promotes LDHA-mediated aerobic glycolysis and colorectal cancer progression by p53 degradation.. Journal of translational medicine, 24(1). https://doi.org/10.1186/s12967-026-08056-7
MLA Jipeng Liu, et al.. "FBXO39 promotes LDHA-mediated aerobic glycolysis and colorectal cancer progression by p53 degradation.." Journal of translational medicine, vol. 24, no. 1, 2026.
PMID 41923267 ↗

Abstract

[BACKGROUND] Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Ubiquitination modification is extensively involved in various biological processes, including aerobic glycolysis and tumor development. TP53 mutations are present in nearly half of CRC patients, while in p53-wild type CRC, effective therapeutic targets remain relatively limited.

[METHODS] We employed bioinformatics methods to systematically analyze the expression and prognostic value of E3 ubiquitin ligase FBXO family members in CRC, with a focus on FBXO39. Through in vitro experiments such as CCK-8 assay, EdU cell proliferation assay, colony formation assay, glucose metabolite measurement, oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) analyses, as well as in vivo experiments including cell-derived xenograft models, we elucidated the biological functions of FBXO39 in CRC. Furthermore, we explored its molecular mechanisms through molecular docking, co-immunoprecipitation (Co-IP), and ubiquitination assays.

[RESULTS] FBXO39 expression was significantly higher in CRC tissues than in adjacent normal tissues, and its high expression was associated with poor patient prognosis. Functional experiments demonstrated that FBXO39 significantly promoted CRC cell proliferation both in vitro and in vivo. Mechanistically, FBXO39 directly bound to the p53 protein and promoted its ubiquitination-mediated degradation in p53-wild type CRC cells. Further investigations revealed that FBXO39 overexpression enhanced the aerobic glycolysis capacity of CRC cells, while its knockdown inhibited this process. Mechanistically, FBXO39 enhanced aerobic glycolysis and promoted tumor cell proliferation by upregulating lactate dehydrogenase A (LDHA) expression in a p53-dependent manner.

[CONCLUSION] This study reveals a novel mechanism for p53 protein downregulation in p53-wild type CRC, elucidates the role of FBXO39 in regulating aerobic glycolysis through the p53/LDHA axis to promote tumor progression, and provides new insights into the function of FBXO39 in metabolic reprogramming in CRC.

[SUPPLEMENTARY INFORMATION] The online version contains supplementary material available at 10.1186/s12967-026-08056-7.

🏷️ 키워드 / MeSH 📖 같은 키워드 OA만

같은 제1저자의 인용 많은 논문 (5)

📖 전문 본문 읽기 PMC JATS · ~62 KB · 영문

Introduction

Introduction
Colorectal cancer (CRC) is one of the leading causes of global cancer-related morbidity and mortality [1]. CRC patients diagnosed early and undergoing radical resection often achieve favorable clinical outcomes, with a five-year survival rate exceeding 90% [2]. However, due to the lack of specific early symptoms, many patients are diagnosed at an advanced or even late stage [3]. Treatment options for advanced CRC are limited; surgical resection is often not feasible, and current systemic therapies, such as chemotherapy, targeted therapy, and immunotherapy, are generally suboptimal, resulting in a five-year survival rate of less than 15% and a high propensity for recurrence [4]. Therefore, identifying reliable prognostic biomarkers could better predict patient survival outcomes.
Metabolic reprogramming is a fundamental hallmark of malignant progression in cancer cells [5]. Aerobic glycolysis, known as the Warburg effect, plays a critical role in the progression of various malignancies, including CRC [6–8]. P53, a central transcription factor, plays a pivotal role in maintaining genomic integrity, regulating cell cycle progression, and modulating metabolic pathways [9]. Although the p53 tumor suppressor pathway exerts anti-cancer functions in various cancers, this pathway is often inactivated in many tumors [10, 11]. For instance, in CRC, TP53 gene mutations occur in approximately half of all patients [12, 13]. Mutant p53 loses its wild-type function, failing to induce cell cycle arrest and apoptosis, thereby allowing cells with DNA damage to proliferate continuously, accumulate more mutations, and ultimately drive malignant tumor progression [14]. Notably, even in CRC with wild-type TP53, p53 protein expression is often low, the reasons and specific mechanisms for which are not yet fully understood.
Ubiquitination, as a crucial post-translational modification, involves a cascade of enzymes including E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin ligases [15, 16]. This process, by specifically targeting proteins and labeling them with specific polyubiquitin chains, guides proteasome-dependent degradation, regulates protein stability, and is extensively involved in processes such as cell cycle control, metabolic reprogramming, and tumor development. The FBXO family is an important subfamily of F-BOX proteins within the E3 ubiquitin ligases, playing a key role in the ubiquitination process [17, 18]. Several FBXO members are involved in CRC progression by regulating the ubiquitination of specific substrates. For example, FBXO8 and FBXO32 exhibit downregulated expression in CRC tissues and act as tumor suppressors [19, 20]. Conversely, FBXO5, FBXO22, and FBXO44 show upregulated expression in CRC tissues and promote tumor progression [21–23]. Multiple bioinformatics studies have indicated associations between FBXO39 and tumors such as breast cancer, cervical squamous cell carcinoma, and osteosarcoma, suggesting its potential prognostic value [24, 25]. However, the specific biological role of FBXO39 in CRC and its underlying molecular mechanisms remain unclear.
In this study, we first established the biological function of FBXO39 in promoting CRC progression. Furthermore, we discovered that FBXO39 promotes the ubiquitination and degradation of the p53 protein. Subsequently, we confirmed that FBXO39, by degrading p53, relieves the inhibitory effect of p53 on lactate dehydrogenase A (LDHA), ultimately driving aerobic glycolysis and tumor cell growth through the upregulation of LDHA.

Materials and methods

Materials and methods

Bioinformatics analysis
The transcriptomic profiles and comprehensive clinical phenotype data of COAD patients were obtained from the UCSC Xena platform, with progression-free interval (PFI) selected as the primary survival endpoint. All statistical analyses and visualizations were performed using R software (version 4.5.2). Survival analyses, including univariate and multivariate Cox proportional hazards regression, were conducted using the survival and survminer packages, employing a complete-case analysis strategy to handle missing clinical covariates. The proportional hazards (PH) assumption was verified using Log-Log plots.Single-cell RNA sequencing data (dataset GSE178341) were re-analyzed to characterize the cellular distribution of FBXO39. We performed cell type annotation, dimensionality reduction (UMAP), and lineage tracing (Sankey diagrams) to validate the epithelial origin of FBXO39-expressing cells.The protein-protein interaction between FBXO39 and P53 was modeled using the HDOCK server and visualized with PyMOL; the binding affinity was quantitatively predicted via the PRODIGY web server. For transcriptional regulation analysis, the binding of P53 to the LDHA promoter was predicted based on the position weight matrix (PWM) from the JASPAR database. The identification of high-confidence binding sites was performed using a custom Python script (utilizing the NumPy library), and their significance was assessed through Monte Carlo simulations.

Clinical sample analysis
The CRC specimens used in this study were collected from patients at the Second Affiliated Hospital of Nanchang University. These patients were postoperatively pathologically diagnosed with CRC and had not received neoadjuvant therapy. This cohort included 30 CRC patients, from whom matched tumor and adjacent normal tissue specimens were acquired. All human sample collection procedures were performed with written informed consent from the patients. The study was approved by the Clinical Research Ethics Committee of the Second Affiliated Hospital of Nanchang University ([2019] No. (053)).

Cell lines and culture
The human CRC cell lines RKO and HCT116 were acquired from BOSTER Biological Technology Co., Ltd. (Wuhan, China). All cell lines in this study were cultured in a sterile, humidified incubator at 37 °C using RPMI-1640 medium (Solarbio, China), supplemented with antibiotics and 10% fetal bovine serum (FBS; Excell, Uruguay).

Western blotting
The following primary antibodies were used in Western Blotting experiments: anti-FBXO39 (1:1000; Thermo-Fisher, USA), anti-p53 (1:2000; Proteintech, China), anti-LDHA (1:1000; Proteintech, China), anti-NEDD8-Culin-1 (1:2000; Proteintech, China), anti-ubiquitin (1:1000; Proteintech, China), and anti-tubulin (1:10000; Proteintech, China). After electrophoresis and transfer, PVDF membranes were incubated with primary antibodies on a shaker at 4 °C overnight. Subsequently, the membranes were washed three times with TBST (Servicebio, China) and probed with anti-rabbit or anti-mouse secondary antibodies (1:5000; Proteintech, China) for 1 hour. After three TBST washes, bands were visualized using an enhanced chemiluminescence (ECL) system. Finally, images were captured and grayscale quantification was performed using ImageJ software (version 1.51).

Lentiviral transfection and stable cell line construction
Lentiviruses for FBXO39 knockdown and overexpression were synthesized by Hanbio Biotechnology Co., Ltd. (Wuhan, China). Stable FBXO39 knockdown or overexpression RKO and HCT116 cell lines were obtained through puromycin selection. qRT-PCR and Western blotting confirmed construction efficiency.

RNA extraction and qRT-PCR
Total RNA was isolated from cell and tissue samples using an RNA extraction kit (Beyotime, Beijing, China). Following extraction, cDNA was synthesized using a reverse transcription kit (Beyotime). qRT-PCR amplification was carried out using a PCR kit (Beyotime), with GAPDH as the endogenous reference gene. The 2−ΔΔCt method was applied to determine relative gene expression. Data visualization was conducted with Prism software (v10.1.2). The nucleotide sequences of the primers used are listed in Table 1.

Immunohistochemistry (IHC)
After paraffin embedding of tissue samples, sections were cut to a thickness of 3 micrometers. The sections were incubated with anti-FBXO39 antibody (1:200, Thermo Fisher, USA) at 4 °C overnight. The next day, sections were washed three times with PBST, followed by incubation with an HRP-conjugated secondary antibody. After three PBST washes, DAB staining was performed. Finally, images were captured using a microscope.

CCK-8 assay
A total of 5.0 × 10^3 cells were seeded into each well of 96-well plates. Cell viability was then determined at designated intervals using the Cell Counting Kit-8 (CCK-8; UElandy, China) as per the manufacturer’s protocol. Measurements of absorbance at a wavelength of 450 nm were taken at designated intervals employing a microplate reader.

EdU assay
Cells in the logarithmic growth phase were harvested and seeded in 96-well plates at a density of 2 × 10^4 cells per well, followed by incubation in a cell culture incubator for 8–12 hours. Prior to the assay, the medium was exchanged for a fresh solution containing 50 μM 5-Ethynyl-2’-deoxyuridine (EdU; UElandy, China), followed by a 2-hour incubation. The proliferation rate was ultimately defined as the ratio of EdU-positive cells to the total number of nuclei, following image acquisition with a fluorescence microscope.

Colony formation assay
The clonogenic capacity and long-term proliferation potential of cells were assessed by seeding them in 6-well plates at a density of 1000 cells per well, followed by a 14-day culture period during which the medium was refreshed every third day. After the incubation, colonies were fixed with 4% paraformaldehyde (20 min) and staining with 0.1% crystal violet. Colony counting was performed using ImageJ (v1.8).

CHX chase assay
For the protein stability assay, cells stably transduced with lentivirus were treated with 25 μg/ml cycloheximide (CHX; HY12320, MedChemExpress) for specified time periods. After treatment, cells were harvested and lysed using cell lysis buffer (87787, Thermo Fisher) supplemented with both protease and phosphatase inhibitors (78442, Thermo Fisher). The resulting lysates were then subjected to Western blot analysis.

Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR)
Mitochondrial respiration and glycolytic function were measured with an XF96 Extracellular Flux Analyzer. The XF Cell Mito Stress Test and XF Glycolysis Stress Test kits (Seahorse Bioscience, USA) were used in accordance with the manufacturer’s guidelines. Data visualization was carried out using Prism.

Co-immunoprecipitation and ubiquitination assays
The co-immunoprecipitation (Co-IP) experiment was performed as follows: Cells were lysed with pre-cooled RIPA buffer containing protease and phosphatase inhibitors, followed by supernatant collection (4 °C, 12,000 rpm, 10 min). The supernatant was incubated with 6 μg of primary antibody at 4 °C with gentle shaking overnight. The next day, 40 μL of Protein A/G PLUS-agarose beads (Beyotime, China) were added and incubated at 4 °C with shaking for 8–12 h. After incubation, beads were collected by centrifugation at 2500 rpm for 10 min at 4 °C, and the precipitate was subjected to Western blot analysis. For the ubiquitination assay, cells with FBXO39 overexpression or knockdown were pretreated with the proteasome inhibitor MG132 for 6 hours before lysis. Subsequently, co-immunoprecipitation was performed using an anti-p53 antibody, followed by Western blot analysis with an anti-ubiquitin antibody.

Subcutaneous xenograft tumor model
Five- to six- week-old male BALB/c nude mice were purchased from Ziyuan Laboratory Animal Technology Co., Ltd. (Hangzhou, China) and randomly divided into experimental groups (n = 5 per group). After one week of acclimatization under specific pathogen-free (SPF) conditions, each mouse received a subcutaneous injection in the axilla with 1 × 10^6 CRC cells transduced with FBXO39 knockdown or negative control (NC) lentivirus. Tumor formation was monitored regularly after inoculation, and tumor volume was measured every 5 days. For in vivo imaging, mice were anesthetized with isoflurane and analyzed using an in vivo imaging system (RWD, China). After 6 weeks, all mice were humanely euthanized under isoflurane anesthesia, and tumors were excised for further analysis.

Chromatin immunoprecipitation quantitative PCR (ChIpqpcr)
ChIPqPCR was performed using p53wildtype CRC cell lines. Cells were crosslinked with 1% formaldehyde for 10 min at room temperature, and the reaction was quenched with glycine. After lysis, chromatin was sheared by sonication to fragments of 200–500 bp. A portion of the sheared chromatin was saved as the “Input” control. The remaining chromatin was incubated overnight at 4 °C with Protein A/G magnetic beads together with either a p53specific antibody (experimental group) or normal rabbit IgG (negative control group). The immunoprecipitated complexes were washed, eluted, and reversecrosslinked at 65 °C overnight. DNA was then purified.
Enrichment of the specific LDHA promoter region was detected by qPCR using the following primers:
Forward: 5′GTAGAGATGGGGACCCACTG3′
Reverse: 5′AGTACTTCGGAAGGCTAAGG3′
The relative enrichment was calculated by the ΔΔCt method, normalizing to the Input control and comparing with the IgG control group0.2.16. Dual-luciferase Reporter Assay
To validate the direct regulatory effect of p53 on the activity of the LDHA gene promoter, a dual-luciferase reporter assay was performed. Reporter plasmids containing either the wild-type (WT) or mutant (MUT) LDHA promoter sequence were co-transfected with either a p53 overexpression plasmid or an empty vector control into p53-wild-type CRC cells (HCT116 and RKO). The Renilla luciferase reporter plasmid pRL-TK was co-transfected as an internal control to normalize for transfection efficiency. Forty-eight hours after transfection, both Firefly and Renilla luciferase activities in cell lysates were measured using a dual-luciferase reporter assay kit. The relative transcriptional activity of the LDHA promoter was calculated by normalizing the Firefly luciferase activity to the corresponding Renilla luciferase activity.

Statistical analysis
Statistical analyses were performed using R (v4.2.2) and GraphPad Prism (v10.1) software. Data are presented as the mean ± standard deviation. Specifically, for comparisons between two groups, two-tailed Student’s t-tests (paired or unpaired, as appropriate) were used for normally distributed data, while the Mann-Whitney U test was applied for data that deviated from normality. Differences in survival curves were assessed with the Log-rank test. p < 0.05 was considered statistically significant.

Results

Results

Identification of FBXO39 in colorectal cancer and its clinical value as a risk factor
The F-box only (FBXO) family constitutes a key component of the SCF E3 ubiquitin ligase complex, which regulates diverse biological processes including cell cycle, metabolism, and tumor progression via ubiquitin-mediated protein degradation [14]. To identify FBXO members with potential clinical relevance in CRC, we performed a systematic screening of all 45 FBXO family genes. Based on the TCGA database, we performed differential expression analysis of the 45 FBXO family genes in CRC and visualized a subset of up- and down-regulated members via a heatmap, thereby preliminarily screening FBXO proteins potentially critical in CRC progression (Fig. 1A). Subsequently, to evaluate the prognostic significance of these differentially expressed genes, we used overall survival (OS) and disease-free survival (DFS) as clinical endpoints and performed Cox regression analysis based on TCGA data (Fig. 1B) and the GEO dataset GSE39582 (Fig. 1C), respectively, to identify risk and protective factors associated with prognosis. The results showed that FBXO39 was the only FBXO gene identified as an independent risk factor in both analyses. Based on the above findings, we further investigated the expression of FBXO39 in CRC. Analysis of TCGA data showed that the overall expression level of FBXO39 was significantly elevated in CRC tissues compared to normal tissues (Fig. 1D). Paired comparative analysis between tumor and normal tissues further confirmed that FBXO39 expression was significantly upregulated in tumors (Fig. 1E). To dissect the expression distribution of FBXO39 at the single-cell level, we analyzed single-cell RNA sequencing data. The cell cluster map displays the distribution of major cell types in CRC tissues (Fig. 1F) and their characteristic gene expression (Fig. 1G). A density plot suggests that FBXO39 is mainly expressed in stromal cells and epithelial cells (Fig. 1H). A Sankey diagram further reveals that FBXO39 expression primarily originates from intestinal epithelial cells, with the vast majority derived from tumor cells (Fig. 1I). Quantitative comparison showed that within intestinal epithelial cells, FBXO39 expression in tumor cells was 6.1 times higher than in normal epithelial cells (Fig. 1J). To systematically evaluate the prognostic value of FBXO39, we performed univariate and multivariate Cox regression analyses based on TCGA data. The results indicated that FBXO39 could serve as an independent prognostic risk factor (Table 2). Further stratified analysis by tumor stage showed that high FBXO39 expression retained significant prognostic value in stage III and IV patients, while no significant association was observed in stage I and II patients (Fig. 1K). The proportional hazards assumption test indicated that the covariates met the proportional hazards assumption (Fig. 1L). Finally, we validated the prognostic significance of FBXO39 through survival analysis. Analysis based on TCGA data demonstrated that high FBXO39 expression was significantly associated with poorer OS and DFS (Fig. 1M, N). To independently verify this conclusion, we used the KM-plotter database as an external validation set, and the results similarly showed that high FBXO39 expression was significantly associated with worse OS and DFS (Fig. 1O, P). In summary, we identified FBXO39 as an independent risk factor with abnormally elevated expression in CRC, and its expression level consistently correlates with poor patient prognosis.

FBXO39 expression is upregulated in CRC
We detected FBXO39 expression levels in 30 pairs of collected CRC and matched normal tissue samples. qRT-PCR analysis revealed that the mRNA expression level of FBXO39 in CRC tissues was significantly higher than in paired normal tissues (Fig. 2A, B). Furthermore, Western blotting analysis indicated that the protein expression level of FBXO39 was also markedly upregulated in CRC tissues compared to adjacent normal tissues (Fig. 2C, D). Subsequently, immunohistochemistry also confirmed the upregulation of FBXO39 in CRC tissues (Fig. 2E, F). Finally, we evaluated data from a retrospectively collected CRC cohort at the Second Affiliated Hospital of Nanchang University and found that patients with high FBXO39 expression had poorer OS and DFS than patients with low FBXO39 expression (Fig. 2G, H). In conclusion, FBXO39 is upregulated in CRC and associated with a worse prognosis.

FBXO39 enhances CRC cell growth both in vitro and in vivo
We constructed RKO and HCT116 cell lines with stable FBXO39 knockdown and overexpression for subsequent experiments to investigate the specific function of FBXO39 in CRC. These two cell lines are also p53-wild type cells in CRC (Fig. 3A–D). CCK-8 assay results showed that FBXO39 overexpression promoted CRC cell growth, while FBXO39 knockdown inhibited their growth (Fig. 3E, F). EdU assay results further demonstrated that FBXO39 overexpression enhanced the proliferative capacity of CRC cells, while FBXO39 knockdown exhibited proliferation inhibitory effects (Fig. 3G, H). Additionally, colony formation assays revealed that the OE-FBXO39 group formed more cell colonies than the control group, while the sh-FBXO39 group showed significantly reduced colony numbers (Fig. 3I, J). Finally, through subcutaneous xenograft model validation, we found that compared with the control group, tumor growth rate was significantly slowed in sh-FBXO39 group mice, with both final average tumor volume and average weight markedly reduced (Fig. 3K–N). In summary, FBXO39 demonstrated effects in promoting CRC progression in both in vitro and in vivo experiments.

FBXO39 reduces p53 protein levels and directly interacts with p53 in CRC cells with wild-type p53
We employed Ubibrowser 2.0 software for predictive analysis of potential FBXO39 binding proteins, with results indicating that FBXO39 may interact with the tumor suppressor p53 (Fig. 4A). We subsequently further verified whether FBXO39 regulates p53 expression. Western blot experiments demonstrated that upregulating FBXO39 expression decreased p53 protein levels, whereas downregulating FBXO39 increased p53 protein expression (Fig. 4B, C). However, changes in FBXO39 expression did not significantly affect p53 mRNA levels (Fig. 4D, E). To further investigate whether FBXO39 directly interacts with p53 in CRC cells, we performed co-immunoprecipitation (co-IP) assays, which confirmed a binding relationship between the two proteins (Fig. 4F, G). Furthermore, molecular docking analysis supported their direct interaction, with Fig. 4H depicting the binding sites from protein–protein docking and Fig. 4I showing the corresponding binding energy. In summary, this study discovered that in p53-wild type RKO and HCT116 CRC cells, FBXO39 can reduce p53 protein levels and directly bind to p53.

FBXO39 facilitates the degradation of p53 protein through the ubiquitin-proteasome pathway
We conducted further investigations to elucidate the specific molecular mechanism by which FBXO39 regulates p53 expression in p53-WT CRC cells. Our existing results indicated that FBXO39 directly binds p53 and downregulates its protein expression without significantly affecting its mRNA level, suggesting FBXO39 might regulate p53 protein stability through post-translational modification pathways. Given that FBXO39 belongs to the E3 ubiquitin ligase family, we hypothesized it might mediate ubiquitin-dependent degradation of p53. First, we assessed p53 protein stability using a cycloheximide chase assay. Results showed that FBXO39 overexpression significantly promoted p53 protein degradation, whereas FBXO39 knockdown effectively delayed the p53 degradation process (Fig. 5A–D). To further verify whether FBXO39 regulates p53 through the proteasomal pathway, we treated cells with the proteasome inhibitor MG132. Results demonstrated that in control cells, MG132 caused p53 protein accumulation, indicating basal levels of proteasomal degradation of p53; in FBXO39-overexpressing cells, MG132 completely blocked the FBXO39-induced p53 decrease; whereas in FBXO39-knockdown cells, where p53 was already at elevated levels, MG132 treatment did not cause further accumulation (Fig. 5E,F). These results indicate that FBXO39 regulates p53 stability through the proteasomal pathway. Furthermore, we detected p53 ubiquitination levels via an in vivo ubiquitination assay. Using a p53 antibody for co-immunoprecipitation, we found that FBXO39 overexpression significantly enhanced p53 polyubiquitination, whereas FBXO39 knockdown markedly attenuated this modification (Fig. 5G,H). To provide further evidence that FBXO39 directly regulates p53 ubiquitination through its E3 ligase activity, we employed MLN4924 for intervention. MLN4924 is a selective NEDD8-activating enzyme inhibitor that blocks the activity of CRL-type E3 ubiquitin ligases by inhibiting the neddylation of Cullin proteins. In RKO cells, FBXO39 overexpression led to decreased p53 protein levels, and co-treatment with MLN4924 reversed this effect (Fig. 5I). Concurrently, we detected that MLN4924 treatment effectively inhibited the binding of NEDD8 to CULIN-1, confirming the successful pharmacological action of the inhibitor in the experimental system (Fig. 5I). Repetition of the experiment in the HCT116 cell line yielded entirely consistent results (Fig. 5J). In summary, FBXO39, as an E3 ubiquitin ligase, reduces p53 protein levels in p53-WT CRC cells by promoting p53 polyubiquitination and subsequent proteasomal degradation.

FBXO39 enhances aerobic glycolysis in CRC cells
Multiple studies have reported that wild-type p53 can inhibit glycolysis and promote oxidative phosphorylation, thereby exerting tumor-suppressive effects by inhibiting the Warburg effect [26–28]. We therefore hypothesized that FBXO39 might promote CRC progression by regulating aerobic glycolysis. We tested this hypothesis by measuring key parameters of glucose metabolism. Results showed that FBXO39 overexpression promoted glucose uptake, glucose-6-phosphate (G6P) accumulation, lactate secretion, and ATP production in RKO and HCT116 cells; whereas FBXO39 knockdown reduced the levels of these metabolites (Fig. 6A, B), indicating that FBXO39 promotes glucose metabolism. We assessed the impact of FBXO39 on total glycolytic flux by sequentially adding glucose, oligomycin, and 2-deoxyglucose (2-DG) at different time points and measuring the extracellular acidification rate (ECAR) to reflect glycolytic flux. Results demonstrated that FBXO39 overexpression significantly increased ECAR, while its knockdown decreased ECAR (Fig. 6C, D, G, H). Additionally, we evaluated mitochondrial respiration by measuring the oxygen consumption rate (OCR), sequentially adding the oxidative phosphorylation inhibitor oligomycin, the mitochondrial uncoupler carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP), and a mixture of the mitochondrial complex I inhibitor rotenone and the mitochondrial complex III inhibitor antimycin A (Rote/AA). We found that FBXO39 overexpression inhibited both basal and maximal mitochondrial respiration, whereas its knockdown promoted these two types of respiration (Fig. 6E, F, I, J). In summary, FBXO39 promotes aerobic glycolysis in CRC cells while simultaneously inhibiting mitochondrial respiration.

FBXO39 promote tumor cell growth and aerobic glycolysis by increasing LDHA expression via p53 in p53-wild type CRC cells
Lactate dehydrogenase A (LDHA) is a key rate-limiting enzyme in aerobic glycolysis. It catalyzes the conversion of pyruvate to lactate while regenerating NAD+, thereby ensuring the high-speed and continuous operation of glycolysis to support the malignant proliferation needs of tumor cells [29, 30]. Notably, LDHA has been confirmed as an important downstream target of wild-type p53 in regulating glycolysis [31]. Based on this, we hypothesized that in p53-wild type CRC cells, FBXO39 might downregulate LDHA expression levels through the p53 signaling pathway, thereby inhibiting tumor cell aerobic glycolysis and growth. We first investigated the regulatory role of FBXO39 on LDHA expression. Knocking down FBXO39 in p53-wild type CRC cells HCT116 and RKO significantly downregulated LDHA at both mRNA and protein levels (Fig. 7A, B). Conversely, overexpressing FBXO39 significantly upregulated LDHA expression (Fig. 7C, D). To dissect the transcriptional regulatory mechanism of LDHA, we analyzed its promoter region using the JASPAR database and identified potential p53 binding motifs (Fig. 7E). Among these, the site located at positions +274 to + 293 upstream of the transcription start site was the most probable binding site (Fig. 7F). To verify whether p53 directly binds to this site, we performed chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). The results showed that, compared to the IgG control, the LDHA promoter fragment was significantly enriched by the p53 antibody (Fig. 7G), demonstrating specific binding of p53 to this region. A further luciferase reporter assay confirmed the specificity of this interaction: when p53 was overexpressed, the activity of the LDHA promoter containing the wild-type (WT) p53 binding site was significantly inhibited, and this inhibitory effect was abolished when the binding site was mutated (MUT) (Fig. 7H). These results directly demonstrate that p53 inhibits LDHA transcription by binding to a specific region of its promoter. Subsequently, we explored the functional impact of this regulatory pathway. Knocking down FBXO39 in HCT116 cells significantly inhibited cell proliferation, and overexpressing LDHA rescued this phenotype (Fig. 7I, J). Next, to more directly demonstrate that FBXO39 mediates its function through LDHA, we performed a rescue experiment. Western blot confirmed successful LDHA knockdown in the context of FBXO39 overexpression (Fig. 7K). Metabolic analysis showed that FBXO39 overexpression significantly promoted the production of key glycolytic metabolites (Fig. 7L) and both glycolytic rate and capacity (ECAR) (Fig. 7M), while inhibiting mitochondrial basal and maximal respiratory oxygen consumption rates (OCR) (Fig. 7N). Concurrent knockdown of LDHA completely blocked these metabolic changes induced by FBXO39 overexpression (Fig. 7L, M, N). Next, to clarify the central role of p53 in this regulatory pathway, we interfered with p53 expression while knocking down FBXO39. Western blot results showed that p53 deletion significantly attenuated the inhibitory effect of FBXO39 knockdown on LDHA expression (Fig. 7O). At the metabolic level, the glycolytic inhibitory phenotypes induced by FBXO39 knockdown, including reduced glucose uptake, G6P accumulation, lactate production, and ATP yield, were all reversed by concurrent p53 knockdown (Fig. 7P). Furthermore, the decreased ECAR (Fig. 7Q) and increased OCR (Fig. 7R) caused by FBXO39 knockdown were also partially counteracted by p53 knockdown. Additionally, p53 knockdown partially restored the impaired cell proliferation capacity resulting from FBXO39 knockdown (Fig. 7S). Notably, in p53-deficient HCT116 p53-/- cells, knocking down FBXO39 had no significant effect on LDHA expression (Fig. 7T), further confirming the p53-dependence of this regulatory pathway. Finally, we examined the relationship between FBXO39 and chemotherapy drugs to explore its potential clinical significance. After treating cells with oxaliplatin (RKO IC₅₀ ≈ 15 μM, HCT116 IC₅₀ ≈ 10 μM) for 72 hours, FBXO39 mRNA levels increased significantly (Fig. 7U). Moreover, in our self-established oxaliplatin-resistant cell line (HCT116-OXR), we observed elevated FBXO39 expression accompanied by decreased p53 levels and increased LDHA levels (Fig. 7V), suggesting the FBXO39-p53-LDHA axis may play a role in chemotherapy resistance. In summary, in p53 wild-type CRC, FBXO39 downregulates LDHA expression through a p53-dependent transcriptional repression mechanism, thereby inhibiting tumor cell aerobic glycolytic activity and proliferation capacity.

Discussion

Discussion
CRC represents a significant global health burden, with its high morbidity and mortality rates continuously challenging healthcare systems worldwide [32]. Patients with advanced disease often experience poor prognosis due to chemotherapy resistance and suboptimal responses to immunotherapy [33, 34], highlighting the importance of elucidating the molecular mechanisms underlying CRC development and progression. This study employed systematic bioinformatics approaches to analyze the expression and prognosis of FBXO family genes in CRC, aiming to identify members with the most significant prognostic value.
We thereby identified FBXO39 as a novel oncogene critical for CRC progression. FBXO39 belongs to the E3 ubiquitin ligase family and plays a key role in regulating protein stability [35, 36]. In recent years, multiple bioinformatics studies have reported abnormal FBXO39 expression in various malignancies. Research indicates that FBXO39 is significantly overexpressed in glioma, breast cancer, cervical squamous cell carcinoma, and osteosarcoma, and is closely associated with poor patient prognosis [37–39]. For instance, high FBXO39 expression was detectable in serum exosomes from 86% of breast cancer patients, with its expression levels correlating with clinical stage and HER2 status [38]. Although some studies have reported FBXO39 upregulation in CRC, these were limited to expression detection without in-depth exploration of its biological functions. Overall, existing research on FBXO39 predominantly remains confined to bioinformatics analyses or clinical correlation studies, generally regarding it as an oncogene but lacking mechanistic insights into its specific pro-tumorigenic actions. Based on this, we systematically investigated the biological role of FBXO39 in CRC. Our results demonstrated significantly elevated FBXO39 expression in CRC tissues, with high expression correlating with poorer OS and DFS in patients. Furthermore, both in vitro and in vivo experiments indicated that FBXO39 substantially enhances the proliferative capacity of CRC cells. These findings suggest that FBXO39 may serve as a novel biomarker for poor prognosis in CRC and exerts oncogenic functions in this malignancy.
Metabolic reprogramming represents a key mechanism enabling tumor cells to adapt to hostile microenvironments and sustain rapid proliferation [40]. Enhanced aerobic glycolysis serves as a critical promoter of CRC progression and chemotherapy resistance. Recent years have witnessed numerous studies dedicated to unraveling the specific regulatory mechanisms of aerobic glycolysis in CRC [41]. For example, METTL3 promotes aerobic glycolysis and tumor cell proliferation by stabilizing mRNAs of glycolysis-related genes HK2 and GLUT1 through m6A modification [42]; PRMT1 enhances glycolytic flux by methylating PGK1 to augment its phosphorylation activity [43]; UBTD1 drives aerobic glycolysis and tumor progression by stabilizing c-Myc and upregulating HK2 expression [44]. In this study, we established the crucial role of FBXO39 in aerobic glycolysis in CRC, demonstrating its ability to promote aerobic glycolysis while simultaneously inhibiting mitochondrial respiration in CRC cells. This finding underscores the significant role of FBXO39 in glucose metabolism, suggesting its potential as a therapeutic target in CRC.
To further investigate the specific mechanisms through which FBXO39 regulates aerobic glycolysis, we focused our research on the p53 protein. As a central regulator of cellular metabolism, p53 profoundly influences tumorigenesis through its functional activities. Regarding aerobic glycolysis, p53 negatively regulates this process through multiple direct and indirect transcriptional regulatory pathways, thereby exerting its tumor-suppressive effects [45, 46]. Recent studies have revealed that p53‘s metabolic regulatory functions are precisely controlled by various post-translational modifications. For instance, pyrimidine synthase CAD mediates p53 deamidation at asparagine residues N235 and N239, directly leading to loss of its transcriptional activity [47]; the E3 ubiquitin ligase TRIM33 promotes K48-linked polyubiquitination and degradation of p53, resulting in loss of its glycolytic inhibitory function and ultimately promoting tumorigenesis [31]; lactate in the tumor microenvironment can inhibit p53‘s DNA-binding capacity and impair its tumor-suppressive function through AARS1-mediated p53 lactylation [48]. However, in CRC harboring wild-type TP53, p53 protein frequently exhibits low expression levels, and the underlying mechanisms remain incompletely understood [49]. We explored this mechanism through a series of experiments: first, Co-IP and molecular docking experiments confirmed the interaction between FBXO39 and p53; subsequently, investigations revealed that FBXO39 promotes p53 protein degradation via ubiquitination; ultimately, we demonstrated that FBXO39 promotes aerobic glycolysis and inhibits mitochondrial respiration in CRC cells by downregulating p53. These results provide compelling evidence that FBXO39 promotes aerobic glycolysis and proliferative capacity in CRC cells by ubiquitinating and degrading wild-type p53.
Lactate dehydrogenase A (LDHA) is the key enzyme catalyzing the reduction of pyruvate to lactate while oxidizing NADH generated during glycolysis. It acts as a rate-limiting enzyme in the final step of glycolysis, ensuring high-speed glycolytic flux and providing energy for malignant tumor proliferation [30, 50]. For example, NCAPD3 promotes glycolysis and proliferation in CRC cells by upregulating LDHA transcription through c-MYC [51]. Sodium butyrate inhibits aerobic glycolysis and cell proliferation in CRC by suppressing HIF-1α-mediated LDHA expression [52]. LDHA also serves as a crucial downstream target of p53 in glycolytic regulation, as p53 can downregulate LDHA expression through transcriptional repression or other mechanisms [53].
From a therapeutic perspective, the findings of this study also suggest potential intervention strategies. Our experiments revealed that oxaliplatin treatment induces upregulation of FBXO39 expression, and significant alterations in the FBXO39-p53-LDHA pathway were observed in oxaliplatin-resistant cells, implying this pathway may be involved in chemotherapeutic stress adaptation and the drug-resistant phenotype. However, directly targeting E3 ubiquitin ligases such as FBXO39 poses inherent challenges in drug development, primarily due to their lack of typical active pockets and their functional reliance on protein-protein interaction interfaces, which makes the design of small-molecule inhibitors extremely difficult [54, 55]. Future research could explore indirect modulation strategies, such as utilizing PROTAC technology to degrade key downstream substrates of FBXO39 or developing peptide/peptidomimetic molecules that disrupt the FBXO39-p53 interaction [56]. Furthermore, targeting downstream nodes of this pathway (e.g., LDHA inhibitors) or combining them with existing chemotherapeutic agents may represent more feasible therapeutic approaches.
We therefore hypothesized that FBXO39 promotes LDHA-mediated aerobic glycolysis and tumor cell proliferation by ubiquitinating and degrading p53 protein in CRC cells, thereby relieving p53-mediated transcriptional suppression of LDHA. Experimental validation demonstrated that FBXO39 knockdown suppresses LDHA expression, while FBXO39 overexpression upregulates LDHA; restoring LDHA expression in FBXO39-knockdown cells reverses the proliferation decrease caused by FBXO39 knockdown; FBXO39 knockdown leads to p53 upregulation, LDHA downregulation, and inhibition of cell proliferation and aerobic glycolysis, while concurrent p53 knockdown restores these phenotypes. Direct mechanistic studies, including ChIP-qPCR and luciferase reporter assays, confirmed that p53 binds to the LDHA promoter and represses its transcription, and this repression is alleviated by FBXO39. Moreover, FBXO39 knockdown shows no significant effect on LDHA expression in p53-deficient HCT116 cells. In summary, we confirmed that FBXO39 promotes CRC progression by facilitating p53 ubiquitination and degradation, thereby relieving p53-mediated transcriptional repression of LDHA and upregulating LDHA-mediated aerobic glycolysis (Fig. 8).

Electronic supplementary material

Electronic supplementary material
Below is the link to the electronic supplementary material.

출처: PubMed Central (JATS). 라이선스는 원 publisher 정책을 따릅니다 — 인용 시 원문을 표기해 주세요.

🏷️ 같은 키워드 · 무료전문 — 이 논문 MeSH/keyword 기반

🟢 PMC 전문 열기